r singh a saharan va ram v bhandari a 2012 quot strychnos nux vomica seeds pharmacognostical standardization extraction and antidiabetic activity quot j ayurveda integr med 3 2 pp 80 4
Tổng quan về tác dụng của 20 vị thuốc giải biểu và thuốc phát tán phong thấp
... cutaneous anaphylaxis test PGE2 Prostaglandin E2 PPARα Peroxisome proliferator-activated receptor alpha PPARγ Peroxisome proliferator-activated receptor gamma TNF-α Tumor necrosis factor alpha (yếu ... 2, 2-diphenyl-1-picrylhydrazyl FST Forced swimming test GM-CFS Granulocyte-macrophage colony-stimulating factor GOT (AST) Transaminase glutamic oxaloacetic (Aspartate transaminase) GPT (ALT) Transaminase glutamic ... tân (Asarum heterotropoides Fr var mandshuricum (Maxim.) Ki-tag.) hán thành tế tân (Asarum sieboldii Miq var seoulense Nakai) hoa tế tân (Asarum sieboldii Miq.), họ Mộc hương (Aristolochiaceae)...
- 132
- 1,921
- 3
Báo cáo y học: "Toxic effects of methoxychlor on the episodic prolactin secretory pattern: Possible mediated effects of nitric oxide production" pdf
... [28 ,29 ,31 , 32 ] Data Analysis To identify and characterize prolactin pulses, a computer program (Ultra-analysis), described by Van Cauter [ 34 ] and reviewed by Richard [35 ], was used In this program, a ... http://www.jcircadianrhythms.com/content /4/ 1 /3 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 Lafuente A, Marcó J, Esquifino AI: Pulsatile prolactin secretory patterns throughout the oestrous cycle in the rat J Endocrinol ... comparison of values was done by oneway analysis of variance (ANOVA) Finally, to test the existence of an interaction between MTX and TRH, two ways analysis of variance (ANOVA) was applied Results...
- 9
- 528
- 0
Báo cáo khoa học: In vivo degradation of nitric oxide synthase (NOS) and heat shock protein 90 (HSP90) by calpain is modulated by the formation of a NOS–HSP90 heterocomplex pot
... FEBS Journal 27 5 (20 08) 25 01 25 11 ª 20 08 The Authors Journal compilation ª 20 08 FEBS M Averna et al degradation of calpastatin in kidney of hypertensive rats J Biol Chem 27 6, 38 42 6 38 4 32 43 Salamino ... Ca-mediated excitotoxicity J Neurochem 97, 57–68 18 Araujo IM & Carvalho CM (20 05) Role of nitric oxide and calpain activation in neuronal death and survival Curr Drug Targets CNS Neurol Disord 4, 31 9 32 4 ... domain in vivo J Biol Chem 27 2, 25 43 7 – 25 44 0 Piech A, Dessy C, Havaux X, Feron O & Balligand J (20 03) Differential regulation of nitric oxide synthases and their allosteric regulators in heart and...
- 11
- 344
- 0
Tài liệu Báo cáo khoa học: Antimicrobial effects of H4-(86–100), histogranin and related compounds – possible involvement of DNA gyrase ppt
... H4 mRNA variant H4 -v. 1 and the levels of histone H4-(86–100) and H4-(89–1 02) 529 6 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 (OGP) in various rat tissues and alveolar macrophages Peptides, 26 , ... histogranin, a natural peptide with N-methyl-Daspartate antagonist activity Eur J Pharmacol Mol Pharmacol 24 5, 24 7 25 6 Lemaire S, Rogers C, Dumont M, Shukla VK, Lapierre C, Prasad J & Lemaire I ... for their bactericidal activity against Gram-negative and Grampositive bacteria (Table 1) The bactericidal activities of HNr and H4-(86–100) were comparable, except for Staphylococcus aureus, against...
- 12
- 756
- 0
RESPIRATORY HEALTH EFFECTS OF PASSIVE SMOKING: LUNG CANCER AND OTHER DISORDERS ppt
... were the primary authors: Chapter 1: Steven P Bayard Chapter 2: Jennifer Jinot Chapter 3: Brian P Leaderer2 Chapter 4: Jennifer Jinot Chapters 5/6: Kenneth G Brown3 Chapter 7: Fernando D Martinez4 ... and Aparna M Koppikar.1 Jennifer Jinot and Steven Bayard were the scientific editors AUTHORS Major portions of this revised report were prepared by ICF Incorporated, Fairfax, Virginia, under EPA ... major contract funding provided by the Indoor Air Division within the Office of Air and Radiation's Office of Atmospheric and Indoor Air Programs Steven P Bayard1 was the OHEA project manager with...
- 20
- 377
- 0
Effects of white rice, brown rice and germinated brown rice
... AGGTGACACTATAGAATAGATCATTGCTCCTCCTGAGC AGGTGACACTATAGAATAAAGGTGAAGGTCGGAGTCAA AGGTGACACTATAGAATACACACGGCTCACATTGCAT GTACGACTCACTATAGGGAAAAGCCATGCCAATCTCATC GTACGACTCACTATAGGGAGATCTCGCTCCTGGAAGATG GTACGACTCACTATAGGGACACGAACAGCAAAGCGA ... AGGTGACACTATAGAATAGCTCAGCTGACACAGTTCGT AGGTGACACTATAGAATACAAGCGTGACTTTGGGTCTT GTACGACTCACTATAGGGACCATTCGCATTAACCAGCTT GTACGACTCACTATAGGGAGGGCTTCACTTCTTGCAAAC AGGTGACACTATAGAATAGATCATTGCTCCTCCTGAGC ... nM for reverse primer and 20 0 nM for forward primers 3. 8 .3 Reverse Transcription and Polymerase Chain Reaction (PCR) Reverse transcription and multiplex PCR of RNA samples (50 ng each) were done...
- 18
- 389
- 2
Effects of simultaneous doping with boron and phosphorous on the structural, electronic and optical properties of silicon nanostructures
... Phys Rev Lett 92 (20 04) 046 8 02 G Cantele, et al., Phys Rev B 72 (20 05) 1 133 03 Z Zhou, et al., Phys Rev B 71 (20 05) 24 530 8 M .V Fernandez-Serra, et al., Phys Rev Lett 96 (20 06) 16 6805 L.E Ramos, ... Rev Lett 94 (20 05) 026 805 X Zhao, et al., Phys Rev Lett 92 (20 04) 23 6 805 M .V Fernandez-Serra, et al., Nano Lett (20 06) 26 74 H Peelaers, et al., Nano Lett (20 06) 27 81 F Iori, et al., in preparation ... [30 ] [31 ] [ 32 ] [33 ] [ 34 ] [35 ] [36 ] [37 ] [38 ] [39 ] [40 ] [41 ] [ 42 ] [ 43 ] [44 ] [45 ] [46 ] [47 ] [48 ] [49 ] [50] [51] [ 52] [ 53] [ 54] M Fujii, et al., Appl Phys Lett 85 (20 04) 1158 D .V Melnikov, J .R Chelikowsky,...
- 8
- 1,024
- 0
effects of flower - like, sheet - like and granular sno2 nanostructures
... voltage of 4. 0 V onto a known resistance in series with the sensor The DC voltage across the sensor was read out using an A/ D converter and data was transferred to the computer for further processing ... by XRD, as shown in Figs 1 3 Major SnO2 cassiterite structure (JCPDS no 41 - 144 5) is observed in all XRD patterns The marked peaks Fig 2a and 3a are attributed to SnO phase (JCPDS no 6 -39 5), which ... sheet-like and granular nanostructures Acknowledgments Supports for this investigation by Tarbiat Modares University and University of Tehran are gratefully acknowledged Fig Temperature-dependent...
- 4
- 325
- 0
The Health Effects of Air Pollution: Separating Science and Propaganda pptx
... Moolgavkar, A Review and Critique of the EPA’s Rationale for a Fine Particle Standard,” Regulatory Toxicology and Pharmacology 42 (20 05): 1 23 - 44 46 T Lumley and L Sheppard, “Time Series Analyses ... http://www.arb.ca.gov/newsrel/ nr 022 4 03. htm 23 For additional examples, see Schwartz, Rethinking the California Air Resources Board’s Ozone Standards 24 For data on asthma emergency room visits and ... Pollution Exposure and Acceleration of Atherosclerosis and Vascular Inflammation in an Animal Model,” Journal of the American Medical Association 29 4 (20 05): 30 03- 10 55 Newspapers carrying articles on...
- 22
- 478
- 0
Looking at the label and beyond: the effects of calorie labels, health consciousness, and demographics on caloric intake in restaurants
... Calorie+traffic light 37 .9% 33 .3% 45 .2% Calorie-only 32 .5% 38 .7% 47 .2% Calorie-only* 34 .8% 46 .7% 40 .5% Control 20 .0% 19 .4% 27 .8% Control 27 .3% 20 .0% 14 .3% Value Taste 62. 5% 74 .2% 80. 6% Value Taste ... up a greater proportion of low-calorie diners (p = 0.099) Age also varied across Ellison et al International Journal of Behavioral Nutrition and Physical Activity 20 13, 10 :21 http://www.ijbnpa.org/content/10/1 /21 ... a Standard errors are in parentheses (heteroskedasticity consistent standard errors) categories as younger patrons (ages 18 34 ) were more likely to order medium- or high-calorie entrées; conversely,...
- 9
- 420
- 0
báo cáo hóa học:" The effects of stochastic resonance electrical stimulation and neoprene sleeve on knee proprioception" doc
... Financial support was received from the UNC Injury Prevention Research Center Student Small Grant Program The authors thank James B Niemi and Susan E D'Andrea of Afferent Corporation (Providence, ... distributed and a Friedman repeated measures analysis of variance on ranks was performed to determine overall significance Frequency distributions of all four conditions were examined and they appeared ... Proprioceptive training and prevention of anterior cruciate ligament injuries in soccer Journal of Orthopaedic and Sports Physical Therapy 20 01, 31 (11):655-660 Pai Y-C, Rymer WZ, Chang RW, Sharma L:...
- 9
- 506
- 0
Báo cáo hóa học: " Genetic diversity and silencing suppression effects of Rice yellow mottle virus and the P1 protein" doc
... Fauquet C, Van Regenmortel M: Comparison of molecular and immunological typing of 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 isolates of Rice yellow mottle virus Arch Virol 20 02, ... Expertise and Valuation Department 24 25 References 10 11 12 13 14 15 16 17 18 19 20 21 22 23 Aravin AA, Klenov MS, Vagin VV, Rozovskii YM, Gvozdev VA: Role of double-stranded RNA in eukaryotic gene ... different RNAs, microRNAs (miRNA) and small-interfering RNAs (siRNA), have been characterized [3] RNA-dependent RNA polymerase activity (RdRP) leads to production of dsRNAs molecules that are recognized...
- 12
- 384
- 0
Báo cáo khoa học: "Immunostimulatory effects of anionic alkali mineral complex solution Barodon in porcine lymphocytes " potx
... of Davis et al [7] Briefly, collected blood was mixed with Table Composition of major ingredients for Barodon Ingredient Amount Na2SiO3 K2CO3 Na2CO3 Na2B4O7 C12H22O11 AgNO3 NaCl Na2S2O3 H2O 600 ... Cells were harvested at glass fiber filter strips (BRANDEL Inc., Gaithergurg, MD, USA) using a cell harvester (Cambridge Techonology, Inc., Watertown, MA, USA) and transferred to the scintillation ... in TTB was added and incubated at room tem- perature for 40 ABC reagent (avidin DH & biotinylated horseradish peroxidase, reagent A & B) was diluted to : 25 0 in TTB 30 prior to washing and blotting...
- 10
- 346
- 0
Báo cáo lâm nghiệp: "The effects of elevated CO 2 and water stress on whole plant CO 2 exchange, carbon allocation and osmoregulation in oak seedlings" docx
... Tree Physiol 13, 2 83- 29 6 Alexander JD (19 93) Plant water relations and the effects of elevated CO a review and sug: gestions for future research Vegetatio 1 04/ 105, 47 - Tyree MT, 62 Tyree MT, Jarvis ... 43 , 1 131 -1 139 CO and Coleman JS, Bazzaz FA (19 92) Effects of CO and tem2 growth and resource use of co-occurring C and C annuals Ecology 73, 1 24 4- 125 9 Conroy JP (19 92) Influence of elevated atmospheric ... -1 mass/[leaf mass + stem mass]) Specific leaf mass ratio (SLA, dm g and leaf area ratio (LAR, dm -1 ) ) -1 g were calculated as the leaf area to leaf mass and the leaf area to plant mass, respectively...
- 13
- 284
- 0
Báo cáo khoa học: "Long-term effects of culture establishment from shoot-tip explants in micropropagating oak (Quercus robur L)" pdf
... cytokinins and thidiazuron to stimulate shoot proliferation Biol Plant 30 , 41 4- 42 1 Chalupa V (19 93) Vegetative propagation of oak (Quercus robur and Q petraea) by cutting and tissue culture Ann Sci For ... 50 Suppl, 29 5 -30 7 Coic Y, Lesaint C (19 73) La nutrition minérale en horticulture avancée La Revue Horticole 23 1 6, 29 - 34 DL (19 83) Effects of annual crown pruning and serial propagation an rooting ... Svolba J (1985) Juvenility and serial vegetative propagation of Norway spruce clones Picea abies (Karst) Silv Genet 34 , 42 - 48 San-José MC, Ballester A, Vieitez AM (1988) Factors affecting in vitro...
- 8
- 240
- 0
Báo cáo y học: "Protective effects of total fraction of avocado/soybean unsaponifiables on the structural changes in experimental dog osteoarthritis: inhibition of nitric oxide synthase and matrix metalloproteinase-13" docx
... unsaponifiables (ASU) Osteoarthritis Cartilage 20 08, 16 :37 3 -38 4 29 Fernandes JC, Martel-Pelletier J, Lascau-Coman V, Moldovan F, Jovanovic D, Raynauld JP, Pelletier JP: Collagenase-1 and collagenase -3 ... http://arthritis-research.com/content/11 /2 /R4 1 Figure ral condyles appearance of osteoarthritic articular cartilage from femoMacroscopicand tibial plateaus ral condyles and tibial plateaus Representative ... Nitric oxide and arthritis Arthritis Rheum 19 93, 36 :1 036 -1 044 43 Evans CH, Stefanovic-Racic M, Lancaster J: Nitric oxide and its role in orthopaedic disease Clin Orthop 1995, 31 2: 275 -29 4 44 Cannon...
- 9
- 547
- 0
Báo cáo khoa học: "Pharmacokinetics and Pharmacodynamic Effects of Flunixin after Intravenous, Intramuscular and Oral Administration to Dairy Goats" pptx
... under eliminationsfasen f r de olika doseringsvägarna var: f r intravenös giva.: 3, 6 (2, 0 5,0), intramuskul r giva.: 3, 4 (2, 6-6,8) och peroral giva.: 4 ,3 (3, 4- 6,1) Distributionsvolymen vid "steady ... concentrations obtained after oral administration of flunixin to goats (n=6) Data after intravenous administration are shown as a reference Acta vet scand vol 44 no 3- 4, 20 03 Pharmacokinetics and pharmacodynamic ... were harvested at 60, 45 , 30 , 15 and minutes before and at 5, 15, 30 , 45 , 60, 90, 120 , 150 and 180 minutes and at 4, 5, 6, 8, 10, 12, 16, 22 , 24 , 26 , 28 , 30 , 32 , 34 and 36 h after administration...
- 7
- 381
- 0
Báo cáo y học: ""Shock and kill" effects of class I-selective histone deacetylase inhibitors in combination with the glutathione synthesis inhibitor buthionine sulfoximine in cell line models for HIV-1 quiescence" doc
... 2: 551-5 73 Fraternale A, Paoletti MF, Casabianca A, Nencioni L, Garaci E, Palamara AT, Magnani M: GSH and analogs in antiviral therapy Mol Aspects Med 20 08, 30 :99-110 Rahman I, Marwick J, Kirkham P: Redox ... immunodeficiency virus type promoter J Virol 20 07, 81:109 14- 109 23 Page of 10 (page number not for citation purposes) Retrovirology 20 09, 6: 52 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 Khan ... cellular reservoirs: implications for the development of therapeutic strategies Biochem Pharmacol 20 04, 68:1 23 1 -1 23 8 Rotili D, Simonetti G, Savarino A, Palamara AT, Migliaccio AR, Mai A: Non-cancer...
- 10
- 418
- 0
Báo cáo y học: "Effects of thoraco-pelvic supports during prone position in patients with acute lung injury/acute respiratory distress syndrome: a physiological study" potx
... pressure and esophageal pressure, and the transdiaphragmatic pressure as the difference between esophageal pressure and gastric pressure Pleural pressure change, gastric pressure change, and transpulmonary ... space, and the alveolar dead space were computed from standard formulae Blood pressures (central and arterial) were measured with disposable pressure transducers (Transpec IV L9 74) positioned at ... gas exchange variables Hemodynamics The application of thoraco-pelvic supports caused a significant increase in heart rate and a decrease in stroke volume index and in pulmonary artery pressures,...
- 9
- 357
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25