quot the expert quot interaction the expert as a social form and a result of a personal causal attribution
Báo cáo sinh học: " Response to mass selection when the genotype by environment interaction is modelled as a linear reaction norm" pptx
... σ21 a e a and σ21 are the genetic and environmental variances of slope, and a0 a1 and e σe0 e1 are the genetic and environmental covariances between level and slope, and P = G + E The heritability ... individuals of the same litter The slope of a linear reaction norm is a measure of sensitivity towards environmental change, which can be treated as a trait of the animal [8] Genetic variation for the ... traits related to animal welfare, it may be more relevant to avoid poor animal performance Besides the suffering of the animal and potential costs and worries for the farmer, poor animal performance...
- 20
- 172
- 0
Smoking and reproduction: The oviduct as a target of cigarette smoke ppt
... had a picomolar LOAEL in the ciliary beat frequency assay Many of the compounds in Table were also screened using a chick chorioallantoic membrane (CAM) assay that measures growth of the CAM and ... oviduct: a regulator of local contraction and gamete transport J Cardiovasc Pharmacol 2004, 44 Suppl 1:S248-51 111 Wijayagunawardane MP, Miyamoto A, Taquahashi Y, Acosta TJ, Nishimura M, Sato K: Angiotensin ... femtomolar range (Table 1) In general, if a chemical were inhibitory, it acted in all three bioassays, although the potency and efficacy for a particular chemical varied among the assays Some of the...
- 17
- 733
- 0
Báo cáo khoa học: "Solving Relational Similarity Problems Using the Web as a Corpus" potx
... 2.3 Paraphrase Acquisition Our method of extraction of paraphrasing verbs and prepositions is similar to previous paraphrase acquisition approaches Lin and Pantel (2001) extract paraphrases from ... for each of the six word pairs We then calculate the relational similarity between the stem of the analogy and each of the five candidates, and we choose the pair with the highest score; we make ... (container, content, equative, material, measure, topic, type) For example, exam anxiety is classified as effect and therefore as CAUSALITY, and blue book is property and therefore also PARTICIPANT...
- 9
- 390
- 0
Searching for a Mate: The Rise of the Internet as a Social Intermediary potx
... the ACS) The higher rate of interraciality in HCMST is mainly due to the fact that the HCMST survey was offered only in English, whereas the ACS was offered in a variety of languages Asians and ... Kennedy and Davis 1993), but gay bars were not always safe or pleasant, and the bars inevitably reached only a small percentage of the local gay and lesbian communities Compared to the gay bar, the ... through almost all of the traditional ways has fallen Family of origin and primary and secondary school (the “traditional” institutions based around place of origin) had already declined in importance...
- 50
- 470
- 0
A Portrait of the Artist as a Young Man ppt
... had big voices and big boots and they studied trigonometry That was very far away First came the vacation and then the next term and then vacation again and then again another term and then again ... was not like the smell of the old peasants who knelt at the back of the chapel at Sunday mass That was a smell of air and rain and turf and corduroy But they were very holy peasants They breathed ... would be dark and sleeping There was cold night air in the chapel and the marbles were the colour the sea was at night The sea was cold day 16 A Portrait of the Artist as a Young Man and night:...
- 317
- 341
- 0
báo cáo hóa học:" The PedsQL™ as a patient-reported outcome in children and adolescents with Attention-Deficit/Hyperactivity Disorder: a population-based study" pdf
... Hispanic/Latino, (9.7%) Black/African American, (9.7%) Asian/Pacific Islander, 2(2.8%) Native American or Native Alaskan, and (12.5%) missing The statewide SCHIP sample was representative of low-income ... design, and performed the statistical analysis All authors read and approved the final manuscript Acknowledgements This research was supported by a grant from the David and Lucile Packard Foundation ... state, and national level [3-5] In addition, utilization of HRQOL measures at the population health level may assist in the evaluation of the healthcare needs of a community, and results can be...
- 10
- 538
- 0
Báo cáo toán học: " Code choice in the Chinese as a foreign language classroom" pot
... strategies”); and as a heritage and community language in the diasporas across the world, such as the United States (Xiao Yun 2011; Xing 2009; Chen, Wang and Cai 2010) and Britain (Li and Zhu 2011; ... Charlene, and Patricia Duff 1994 Teachers’ language use in university foreign language classrooms: A qualitative analysis of English and target language alternation The Modern Language Journal ... of China (Hu and Alsagoff 2010; Zhou and Sun 2004) and Taiwan (Chen and Hsin 2011); in post-colonial contexts such as Singapore (Tse and Tan 2011) and Hong Kong (Shum, Tsung and Gao 2011 “Teaching...
- 26
- 523
- 0
báo cáo hóa học:" Code choice in the Chinese as a foreign language classroom" pptx
... strategies”); and as a heritage and community language in the diasporas across the world, such as the United States (Xiao Yun 2011; Xing 2009; Chen, Wang and Cai 2010) and Britain (Li and Zhu 2011; ... Charlene, and Patricia Duff 1994 Teachers’ language use in university foreign language classrooms: A qualitative analysis of English and target language alternation The Modern Language Journal ... of China (Hu and Alsagoff 2010; Zhou and Sun 2004) and Taiwan (Chen and Hsin 2011); in post-colonial contexts such as Singapore (Tse and Tan 2011) and Hong Kong (Shum, Tsung and Gao 2011 “Teaching...
- 26
- 501
- 0
Báo cáo hóa học: "Code choice in the Chinese as a foreign language classroom" potx
... strategies”); and as a heritage and community language in the diasporas across the world, such as the United States (Xiao Yun 2011; Xing 2009; Chen, Wang and Cai 2010) and Britain (Li and Zhu 2011; ... Charlene, and Patricia Duff 1994 Teachers’ language use in university foreign language classrooms: A qualitative analysis of English and target language alternation The Modern Language Journal ... of China (Hu and Alsagoff 2010; Zhou and Sun 2004) and Taiwan (Chen and Hsin 2011); in post-colonial contexts such as Singapore (Tse and Tan 2011) and Hong Kong (Shum, Tsung and Gao 2011 “Teaching...
- 26
- 391
- 0
The Project Gutenberg E Book of The Argentine as a Market, by N. L. Watson potx
... commercial development there is certain of an unfavourable reception But as sand and mud are the only base from Santa Fé to Bahia Blanca—in some cases there being not even firm sand and as dredging ... canvas shoe factories and similar works Even the production of such essentially native goods as “ponchos” has lapsed in favour of German and Italian wares While the manufacture of matches—in the ... rise as, in all probability they will, a rise in wages will be imperative This, in the case of railways would mean an increase in rates, as there are few who are earning more than a reasonable...
- 199
- 354
- 0
The Manager as a Planner and Strategist pdf
... & Mauritz, and England’s Jaeger and Laura Ashley, have attempted to supply fashionable clothes at lower prices, none has succeeded as well as Spanish clothes maker, Zara, whose sales have soared ... Panasonic and JVC brands The advantages and disadvantages of a multidomestic strategy are the opposite of those of a global strategy The major advantage of a multidomestic strategy is that by customizing ... various aspects of a program One of NASA’s major programs was to reach the moon, and one project in this program was to develop a lunar module capable of landing on the moon and returning to the...
- 38
- 526
- 0
Báo cáo khoa hoc:" The chicken as a model to study microchromosomes in birds: a review" potx
... metaphase preparations and usually classified by decreasing size (17! Except for the Falconiformes and particularly the Accipitridae family which has no more than three to six microchromosome pairs ... bird karyotypes seem very well conserved between ratites and carinatas !17! The appearance of microchromosomes could precede bird adaptative radiation at the end of the Jurassic, beginning of the ... standard karyotype description by GTG- and RBG-banding for the chicken, established by the International Committee for the Standardization of the Avian Karyotype, concerns eight pairs of macrochromosomes...
- 11
- 318
- 0
báo cáo khoa học: " Osteonecrosis of the jaw as a possible rare side effect of annual bisphosphonate administration for osteoporosis: A case report" ppsx
... Oral Maxillofac Surg 2003, 61(9):1115-1117 Advisory Task Force on Bisphosphonate-Related Osteonecrosis of the Jaws, American Association of Oral and Maxillofacial Surgeons: American Association ... http://www.jmedicalcasereports.com/content/5/1/477 Page of Figure a) intraoral examination of her left lower jaw with fistula formation and pus on palpation in region 38; b) panoramic radiograph with mixed radiopaque and radiolucent areas surrounding ... by mild to moderate pain on palpation A panoramic radiograph and cone beam computed tomography identified radiolucent areas at the resected apices of teeth 22 and 23 as well as the region surrounding...
- 4
- 233
- 0
Báo cáo y học: "Menstruating from the umbilicus as a rare case of primary umbilical endometriosis: a case report" pot
... presence of endometriotic glands with mucinous type metaplasia and extravasation of the mucinous secretion into the adjacent stroma (Figure 1) No epithelial atypia was seen and the excision appeared ... extravasation of the mucinous Umbilical endometriosis: endometriotic glands with metaplasia of the mucinous type and extravasation of the mucinous secretion into the adjacent stroma Majority of these ... deliveries and had no history of abdominal pain, dyspareunia or infertility She was not using any form of hormonal contraception Her medical history was not significant and she never had any abdominal...
- 3
- 383
- 0
báo cáo khoa học:" The ICF as a common language for rehabilitation goal-setting: comparing client and professional priorities" ppt
... determine the effectiveness of the screening materials and the interview schedule and (Talking Mats™ and the line drawings) The material and procedural efficacy was also assessed and modified as needed ... its design, statistical analysis and drafted the manuscript MG and AVDM participated in its design, data collection and statistical analysis All authors read and approved the final manuscript Competing ... across the nine ICF activities and participation domains The Friedman analysis is a nonparametric statistical test which is an alternative to the repeated analysis of variance measure Statistical...
- 9
- 323
- 0
Báo cáo y học: "Genomic studies of mood disorders - the brain as a muscle" pot
... pharmacotherapy and psychotherapy, with a treadmill supplanting the proverbial Freudian couch The Romans may have had it right with their ideal of mens sana in corpore sano (a healthy mind in a ... Niizato K, Nakamura R, Tsuchiya K, Someya T, Kakita A, Takahashi H, Nawa H: Abnormal expression of epidermal growth factor and its receptor in the forebrain and serum of schizophrenic patients Mol ... state and leaves open the possibility that the opposite may be true that FGFs may be increased - in more manic states, giving an overall mixed picture in brains from bipolar patients As a caveat,...
- 4
- 161
- 0
slike bài giảng ứng dụng xây dựng hệ thống thông tin chương 3 the analyst as a project manager
... Learning Objectives Explain the elements of project management and the responsibilities of a project manager Explain project initiation and the activities in the project planning phase of the ... 17 Activities of the Project Planning Phase Systems Analysis and Design in a Changing World, 3rd Edition 18 Activities of the Project Planning Phase and Their Key Questions Systems Analysis and ... for research paper WBS is foundation for project schedule Building a PERT/CPM Chart Assists in assigning tasks Critical path method Gantt chart and tracking GANTT chart Systems Analysis and Design...
- 40
- 310
- 0
luận văn Toxicity assessment of small molecules using the zebrafish as a model system
... CCGTCGTGGAGACGTCAA CGAGGAGAGGACACAAAGCT TCCACAACTGCTTCCTGATG CACACGACTCAATGCGTACC Subsequently, cDNA was amplified using the SensiMix SYBR Hi-ROX Kit (Bioline; Meridian Life Science) and the reaction ... several parameters: median measurements in the dark and light phases as well as 30 the regressed slope during each phase The startle peak in the velocity actogram was omitted from calculation because ... On the other hand, DMSO was the only chemical which reduced larval activity in the dark and was among the two substances (the other was SB) that exhibited the same effect in the light phase The...
- 58
- 262
- 0
The Stockmarket as a Sourc of Finance
... profitabilityrather than increased cash flow One solutionproposed by Fazzari et al (1988) isto use the q ratio as a measure of the expectedprofitability and cash flows as a measure of the availability of funds ... acceleratortheoryemphasizesoutput as the principaldeterminantof capital expenditures,neoclassicaltheory emphasizescost of capital,modifiedneoclassicaltheoryemphasizescost of capital and output, cash flow theory ... though the information-theoreticapproach assumes the prevalence of capital market constraints and financing hierarchy, it is cast in a neoclassical framework with the usual assumption that managers...
- 52
- 325
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25