0

quot environmental sustainability is a pattern of resource use that aims to meet human needs while preserving the environment so that these needs can be met not only in the present but in the indefinite future quot  

Tài liệu Chiếu sáng trong truyền hình - Television Lighting Television is a means of changing pptx

Tài liệu Chiếu sáng trong truyền hình - Television Lighting Television is a means of changing pptx

Chụp ảnh - Quay phim

... consumer cameras often use a setup, or black level, of zero IRE, rather than the 7.5 IRE broadcast standard Some cameras that automatically boost the signal in low light situations can also be run in ... They can this only if all of the important lighting sources within a scene have the same color temperature A combination of filters and electronic adjustments is used to adapt color cameras to each ... from the subject, it's measured using a reflectance light meter The meter is held near a variety of very light and very dark parts of the subject and pointed toward each part of the subject to be...
  • 6
  • 462
  • 1
Learning english is a piece of cake 1

Learning english is a piece of cake 1

Kỹ năng nói tiếng Anh

... ɡlɪʃ They think English is difficult and it’s hard to memorize new words ðeɪ θɪŋk ˈɪŋ ɡlɪʃ ɪz ˈdɪfɪk əlt ænd ɪts hɑːrd tə ˈmem ə raɪz njuː wɜːdz and grammatical rules In fact, learning English can ... ˈeɪʃ ən doʊnt ˈ wɝːɪ ə ˈbaʊt ˈɡræm ə Don’t be afraid of making mistakes Just try to speak doʊnt biː ə ˈfreɪd ʌv ˈmeɪk ɪŋ mɪ ˈsteɪk dʒʌst traɪ tuː spiːk Speak English as much as possible spiːk ˈɪŋ ...   In fact, she is a sales person! “Improve” = cải thiện, cải tiến I want to improve my English! Many people are worried about learning English ˈmen i ˈpiːpl ɑːr ˈwʌrid ə ˈbaʊt ˈlɝːn...
  • 2
  • 1,669
  • 15
Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot

Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot

Báo cáo khoa học

... GGCTTCCATGGCATACTCCA 616mCARP.F: CTTGAATCCACAGCCATCCA 641mCARP.P: CATGTCGTGGAGGAAACGCAGATGTC 706mCARP.R: TGGCACTGATTTTGGCTCCT 83E2_14.F: GGGATTTCAAGCGATTGCAA 129E2_14.P: CGCCCCATCTGAAAACAACATCATGC ... GTACAAGGAGCCAGGCCAAG 1629p21.P: TCACAGGACACTGAGCAATGGCTGATC 1691p21.R: GTGCTTTGACACCCACGGTA 22mUbiq.F: TCGGCGGTCTTTCTGTGAG 51mUbiq.P: TGTTTCGACGCGCTGGGCG 96mUbiq.R: GTTAACAAATGTGATGAAAGCACAAA ... GGTGTCCCTTCTGGTCCAAA 1297mFoxO1.F: CTAAGTGGCCTGCGAGTCCT 1369mFoxO1.P: CCAGCTCAAATGCTAGTACCATCAGTGGGAG 1445mFoxO1.R: GTCCCCATCTCCCAGGTCAT 1235mMafBx.F, CTGGAAGGGCACTGACCATC 1265mMafBx.P, CAACAACCCAGAGAGCTGCTCCGTCTC...
  • 16
  • 428
  • 0
Báo cáo khoa học: Epl1, the major secreted protein of Hypocrea atroviridis on glucose, is a member of a strongly conserved protein family comprising plant defense response elicitors potx

Báo cáo khoa học: Epl1, the major secreted protein of Hypocrea atroviridis on glucose, is a member of a strongly conserved protein family comprising plant defense response elicitors potx

Báo cáo khoa học

... history because important members in the tree are not known or extinct However, at the intrageneric clade, some clustering was apparent, such as the branches leading to all Magnaporthe ⁄ Gibberella ... from all other fungi Nevertheless, sequence analysis of these two proteins clearly identifies a four-cysteine-containing cerato-platanin domain, and a blastp search always yielded the members of the ... cerato-platanin family as the best hits It is possible that they represent an ancestral cerato-platanin member that is no longer present in the other genera Transcription of epl1 is modulated...
  • 14
  • 494
  • 0
Báo cáo khoa học: EmbR, a regulatory protein with ATPase activity, is a substrate of multiple serine⁄threonine kinases and phosphatase in Mycobacterium tuberculosis doc

Báo cáo khoa học: EmbR, a regulatory protein with ATPase activity, is a substrate of multiple serine⁄threonine kinases and phosphatase in Mycobacterium tuberculosis doc

Báo cáo khoa học

... Walker JC (1999) Kinase interaction domain of kinase-associated protein phosphatase, a phosphoprotein-binding domain Proc Natl Acad Sci USA 96, 7821–7826 32 Chopra P, Singh A, Koul A, Ramachandran ... release of Pi was measured, using the malachite green method, at various time points The Pi release was assayed when ATP or GTP was used as a substrate of EmbR Each time point is the average of the ... as one of the targets for a signal transduction pathway mediated by PknA and PknB If so, this pathway could link cell division and peptidoglycan synthesis with arabinogalactan synthesis, another...
  • 11
  • 402
  • 0
Báo cáo khoa học: The proapoptotic member of the Bcl-2 family Bcl-2 / E1B-19K-interacting protein 3 is a mediator of caspase-independent neuronal death in excitotoxicity pot

Báo cáo khoa học: The proapoptotic member of the Bcl-2 family Bcl-2 / E1B-19K-interacting protein 3 is a mediator of caspase-independent neuronal death in excitotoxicity pot

Báo cáo khoa học

... immunohistochemistry in brains of rats injected intrastriatally with KA Two days after unilateral injection of KA, BNIP3-immunopositive neurons were present in striatal areas adjacent to the site of injection ... nuclei being detected only in areas adjacent to sites of KA injection, and not in the contralateral (CL) striatum (Fig 1C,D) To confirm that the increased expression of BNIP3 after KA BNIP3 in excitotoxicity ... 5¢-GAGAATTC TCG CAG AGC GGG GAG GAG AAC-3¢ and antisense primer 5¢-AT GGATCC TCA AAA GGT ACT AGT GGA AGT TG-3¢ The PCR product was ligated to pGEM-T (Promega) by T -A cloning After the resulting...
  • 9
  • 388
  • 0
This pdF is a sample of the trend database & Monthly Snapshot potx

This pdF is a sample of the trend database & Monthly Snapshot potx

Cơ sở dữ liệu

... campaign On top of that, up to 200 new examples are added each month, and all content can be easily downloaded in various formats, then tailored and presented to your team w w w.t r en d w a ... is a sample of the Monthly Snapshot that was sent to existing Premium clients in September 2012 Along with adding up to 200 new examples to the Trend Database each month, we send clients a curated ... DATABASE » BOOKMARKS M SA E PL Customized example folders, available to export into a single pdf for presentations or to share with colleagues w w w.t r en d w a t chin g c om | TREND DATABA...
  • 27
  • 325
  • 0
báo cáo hóa học:

báo cáo hóa học: " Toll-like receptor 2 signaling is a mediator of apoptosis in herpes simplex virus-infected microglia" pdf

Hóa học - Dầu khí

... DNA fragmentation factor CASP2 and RIPK1 adaptor domain containing protein Fas-associated death domain Fas apoptotic inhibitory molecule Helicase lymphoid specific Interleukin 10 MAP kinase interacting ... 5'-aaatgaccccttcatcacca-3'; Dsip1: 5'-ggtggccctagacaacaaga-3' and 5'-tcaagcagctcacgaatctg-3'; CIDE-B: 5' ctggaactcagctcctccac-3' and 5'- cctccaggaccagtgttagc-3'; caspase-2: 5'- cagctccaagaggtttttcg-3' and 5'- acatccaggggattgtgtgt-3'; ... domain death agonist BCL2/adenovirus E1B-interacting protein Baculoviral IAP repeat-containing BCL2/adenovirus E1B-interacting protein Apoptosis inhibitor TSC22 domain family Cell-death inducing...
  • 7
  • 507
  • 0
101 Ways to Market Your Business 101 Ways to Market Your Business is a collection of marketing pptx

101 Ways to Market Your Business 101 Ways to Market Your Business is a collection of marketing pptx

Quản trị kinh doanh

... business Reward your customers If they buy a certain number of products they can have one free or give them a bonus coupon that they can use on another product Train your employees so that they ... potential visitors need to “log in to view Ask customers what they would like to see offered by your business in the future Organize your marketing and advertising into a plan Create a list of daily, ... reading and studying other business advertising and marketing material Educate yourself with new strategies Form a strategic business alliance that allows you to share knowledge, training, customers,...
  • 8
  • 315
  • 0
This is a transcript of Warren Buffett''''s live interview on CNBC before appearing docx

This is a transcript of Warren Buffett''''s live interview on CNBC before appearing docx

Quản trị kinh doanh

... or in terms of A and all of that sort of thing So state after state has regulations relating to insurance companies that ties in with the rating agencies And the agencies are specified And so ... on But but but no, that did not raise fundamental questions in my mind about either the economy or the market BECKY: Okay, and again, as you're getting ready to head in today to speak to this ... have ratings agencies that go from an A or— a AA rating overnight to a D, I mean, that shows that there's a huge problem with the the system that' s been set up— BUFFETT: There was a huge flaw...
  • 7
  • 325
  • 0
THE SENTENCE (A sentence is a group of words which expresses a complete thought.)

THE SENTENCE (A sentence is a group of words which expresses a complete thought.)

Ngữ pháp tiếng Anh

... sentence is a single clause, it is called a simple sentence (and the clause is called an independent clause) A sentence must contain at least one independent clause  Below are the four types of sentence ... ends with an exclamation mark For example:  What a beautiful girl !  He is going to win ! The Four Sentence Structures  A sentence can consist of a single clause or several clauses When a sentence ... Sentence A declarative sentence  A declarative sentences make statements or assertions For example:  I shall arrive at there  We must not forget that date 2.An imperative sentence  An imperative...
  • 11
  • 584
  • 0
what is clause   (A clause is a group of words that contains a subject and a finite verb)

what is clause (A clause is a group of words that contains a subject and a finite verb)

Ngữ pháp tiếng Anh

... of clause Main clause (independent clause) These can stand alone because they express complete thoughts Subordinate clause (dependent clause) These can t stand alone and need another clause to ... we can all see it They won the match because they were the best players Complete sentence Main clause Simple sentence (complete meaning) Subordinate clause Noun clause Adjective (related) clause ... whom, that, which, where, when, why Ex: The woman who looked happy danced The town where they met was called Smalltown I remember the day when we met each other Subordinate clause There are kinds...
  • 8
  • 621
  • 0
Báo cáo sinh học :

Báo cáo sinh học : " The importance of mathematics in biology is a matter of perennial debate" pot

Báo cáo khoa học

... safe to generalize), in which fibroblast growth factor (FGF) and Wnt signaling are also implicated, and in which the Hes/her cellintrinsic oscillator may not be the only one Robertson least in ... least in so complex a system as a developing embryo, then facts - and indeed understanding - at many levels must be fed into the mathematics Nor should the value of facts and understanding on their ... monumental achievement So ostensibly significant a difference between vertebrates in so fundamental a process seems surprising, and may dwindle (either in extent or in significance) with the accumulation...
  • 2
  • 352
  • 0
Báo cáo toán học:

Báo cáo toán học: "How frequently is a system of 2-linear Boolean equations solvable" ppsx

Báo cáo khoa học

... does not change the value of the integral as long as b ∧ (µ/2 + b) remains positive Proof of Lemma 2.8 We only have to explain preservation of the integral, and 3 why e−λ /6 can be replaced with ... decreasing (increasing) graph function is a monotone decreasing (increasing) function of the code δ For the random graph G(n, p), the components of δ are independent random variables According to ... equations in (1.0.12), in this case is similar to Daud´-Ravelomanana’s main theorem, but e there are some puzzling differences The exponent series in their equation (2) is certainly misplaced; their...
  • 50
  • 328
  • 0
Báo cáo y học:

Báo cáo y học: "SAPHO syndrome: Is a range of pathogen-associated rheumatic diseases extended" ppsx

Báo cáo khoa học

... CARD15 (nucleotide-binding oligomerization domain protein 2/ caspase recruitment domain 15) system in the inflammasome (associated with Crohn disease) leading to a nuclear factorkappa-B overactivation ... with pamidronate: a follow-up of fourteen cases and review of the literature Clin Exp Rheumatol 2009, 27:112-115 Massara A, Cavazzini PL, Trotta F: In SAPHO syndrome antiTNF-alpha therapy may induce ... Combined therapy, including anti-TNF medication and an antibiotic, may be a reasonable solution SAPHO syndrome, representing a constellation of synovitis, acne, palmo-plantar pustulosis, hyperostosis,...
  • 3
  • 334
  • 0
Báo cáo y học:

Báo cáo y học: "Is a purpose of REM sleep atonia to help regenerate intervertebral disc volumetric loss" pdf

Báo cáo khoa học

... require the same buttressing spinal mechanisms for stability They may not require atonia to recuperate the disc height loss in the same way land vertebrates because of their aquatic environment ... known to experience atonic sleep And some readers may argue that the horizontal nature of quadrupeds would not require similar atonia to unload the upright bipedal nature of a human' s spinal biomechanics ... investigations may help define the physical aspects of recuperation during sleep in these mammals Could the finding of mammal size and quantity of sleep be related to the size of the vertebrae and...
  • 5
  • 226
  • 0
báo cáo khoa học:

báo cáo khoa học: " Discovery of microvascular miRNAs using public gene expression data: miR-145 is expressed in pericytes and is a regulator of Fli1" pps

Báo cáo khoa học

... CUUGAAGAGAUAAGAAAACUGGAU Human 5' CUUGAAGGGAAGACAAAACUGGAU Rat 5' UUUGAAGAGAUAAGAAAACUGGAU Dog 5' CUUGAAGAGAAAACAAAACUGGAU 5' 3' 3' 3' 3' Site : Fli1 3’ UTR pos 490-497 3' UUCCCUAAGGACCCUUUUGACCUG || ||||||| 5' UGAAGUUUUUUGCCC-AACUGGAA ... UUCCCUAAGGACCCUU UUGACCUG ||| ||||||| 5' UCA-AUUCAGUGGAUGGCAACUGGAA 5' CAA-AUUCAGUGGAUGGCAACUGGAA 5' UUA-AUUCAGCGGAUGGCAACUGGAA 5' AUAUAUUCAGUGGAUGGCAACUGGAA (b) 3' UUCCCUAAGGACCCUUUUGACCUG || ... |||||| 5' UUAAAUAUUUAGGUU ACUGGAA 5' UUGCAUAUUAAGAUU ACUGGAA 5' UUAAAUAUUUAGGUU ACUGGAA 5' CUGAAUCUUUAGAUU ACUGGAA Volume 1, Issue 11, Article 108 control No significant reduction was observed...
  • 12
  • 242
  • 0
Báo cáo y học:

Báo cáo y học: " A pattern of cerebral perfusion anomalies between Major Depressive Disorder and Hashimoto Thyroiditis" doc

Báo cáo khoa học

... participated in the design of the study, in the acquisition of data and drafted the manuscript All authors read and approved the final manuscript Competing interests The authors declare that they ... MCH participated in the design of the study, in the analysis of the data and drafted the manuscript MC, AS, MFM, GMu and GMe participated in acquisition of data and critical revision of the manuscript ... KMB participated in the design of the study, in the analysis of the data and drafted the manuscript GA participated in the design of the study and performed the statistical analysis PU, MP and...
  • 7
  • 336
  • 0

Xem thêm