qt prolongation is a poor predictor of proarrhythmia liability beyond qt prolongation
Báo cáo y học: "Excess circulating angiopoietin-2 is a strong predictor of mortality in critically ill medical patients"
... Minneapolis, USA) This assay measures biologically active VEGF121 and VEGF165 Statistical analysis Differences between patients and healthy controls were evaluated using a non-parametric Kruskal-Wallis test ... Critical Care Vol 12 No Kümpers et al package (SPSS Inc., Chicago, IL, USA) and the GraphPad Prism software (GraphPad Prism Software Inc San Diego, California, USA) Figure Results Decreased Ang-1 and ... optimal cut-off values Data are displayed as median and range (minimum to maximum) unless otherwise stated All statistical analyses were performed with the SPSS Page of (page number not for citation...
- 9
- 634
- 0
Báo cáo sinh học: " High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" potx
... primary blasts Haematologica 2008, 93:662-669 34 Sharma SV, Haber DA, Settleman J: Cell line-based platforms to evaluate the therapeutic efficacy of candidate anticancer agents Nat Rev Cancer ... Gautschi O, Mack PC, Davies AM, Lara PN, Gandara DR: Aurora kinase inhibitors: a new class of targeted drugs in cancer Clin Lung Cancer 2006, 8:93-98 Page 10 of 10 37 Mazzino A, Muratore-Ginanneschi ... Tanner M: Aurora -A gene is frequently amplified in basal-like breast cancer Oncol Rep 2010, 23:307-312 12 Gautschi O, Heighway J, Mack PC, Purnell PR, Lara PN, Gandara DR: Aurora kinases as anticancer...
- 10
- 618
- 0
o cáo hóa học:" High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" ppt
... primary blasts Haematologica 2008, 93:662-669 34 Sharma SV, Haber DA, Settleman J: Cell line-based platforms to evaluate the therapeutic efficacy of candidate anticancer agents Nat Rev Cancer ... Gautschi O, Mack PC, Davies AM, Lara PN, Gandara DR: Aurora kinase inhibitors: a new class of targeted drugs in cancer Clin Lung Cancer 2006, 8:93-98 Page 10 of 10 37 Mazzino A, Muratore-Ginanneschi ... Tanner M: Aurora -A gene is frequently amplified in basal-like breast cancer Oncol Rep 2010, 23:307-312 12 Gautschi O, Heighway J, Mack PC, Purnell PR, Lara PN, Gandara DR: Aurora kinases as anticancer...
- 10
- 665
- 0
Mobility is a key predictor of change in well being among older adults who experience falls evidence from the vancouver falls prevention clinic cohort
... 2B5, Canada of Physical Therapy, 2177 Wesbrook Mall, University of British Columbia, Vancouver, British c Arthritis M AN U Columbia, V6T 2B5, Canada Research Centre of Canada, 5591 No Road, Richmond ... Physiological falls risk was assessed using the short form of the Physiological Profile Assessment (PPA) 156 The PPA is a valid and reliable [60] measure of falls risk Based on a participant’s performance ... Neuroscience, a Michael Smith Foundation for Health Research (MSFHR) Scholar, a Canadian Institutes of Health Research (CIHR) New Investigator, and a Heart and Stroke Foundation of Canada’s Henry JM SC Barnett’s...
- 29
- 342
- 0
báo cáo sinh học:" Is satisfaction a direct predictor of nursing turnover? Modelling the relationship between satisfaction, expressed intention and behaviour in a longitudinal cohort study" pdf
... satisfaction data at and 18 months using principal component analysis with varimax rotation and Kaiser normalization to ascertain whether the eight factors (Care, Staffing, Development, Relationships, ... leave work on time Resources Adult and Child Availability of equipment(e.g hoists) Availability of supplies (e.g dressings) Mental Health Availability of equipment (e.g audiovisual, art materials, ... quit at years was weak and positive therefore dissatisfaction with staffing, for this cohort, was transitory Shaver and Lacey [31] identified short staffing as a source of nurses' dissatisfaction...
- 12
- 530
- 0
Báo cáo khoa học: "Intensive care unit delirium is an independent predictor of longer hospital stay: a prospective analysis of 261 non-ventilated patients" ppt
... and as thereafter Coma status was also included in each model as a timedependent covariate and was coded similarly Other baseline covariates included in each model were age, gender, race, APACHE ... and Statistical Manual of Mental Disorders Washington, DC: American Psychiatric Association; 1987 Ely EW, Inouye SK, Bernard GR, Gordon S, Francis J, May L, Truman B, Speroff T, Gautam S, Margolin ... relevant covariates, delirium was found to be an independent predictor of longer hospital stay While univariate analysis found an association with higher mortality, that association did not reach...
- 7
- 296
- 0
Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"
... 51:189-197 A ssaoui Y, Zeggwagh AA, Zekraoui A, Abidi K, Abouqal R: Validation of a behavioral pain scale in critically ill, sedated, and mechanically ventilated patients Anesth Analg 2005, 101:1470-1476 ... diagnosis of sepsis on admission to the ICU Eosinopenia may become a helpful clinical tool in ICU practices interpretation of data, and gave the final approval of the manuscript All authors read ... of data NM helped to draft the manuscript, and participated in the acquisi- Page of 10 (page number not for citation purposes) tion of data AZ participated in the coordination of the study AAZ...
- 10
- 597
- 0
Tài liệu .An ARCO Book ARCO is a registered trademark of Thomson Learning, Inc., and is used herein under pptx
... Graduate Management Admission Test, which is a standardized exam given at various locations in the United States and Canada and around the world Throughout North America and in many international ... these arguments differ from that of the stem paragraph (A) is a valid argument: Given anything that is a war, if any war is to be condemned, then all wars are to be condemned (B) is not a valid argument ... as wide of a margin as any candidate in the state’s history (A) she was reelected with as wide of a margin as any candidate in the state’s history (B) she had been reelected with as wide of a...
- 696
- 1,001
- 1
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx
... AGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAG AGAC-3, PTI1-4 (At2g47060): 5-CCCCAAAGAAAATG AGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3 Acknowledgement This project was supported by grants from the Austrian Science ... gene as an internal standard PCRs were performed using the following primers: ACT2 (At3g18780): 5-ACATTGT GCTCAGTGGTGGA-3 and 5-CTGAGGGAAGCAAG AATGGA-3, OXI1 (At3g25250): 5-GACGAGATTATC AGATTTTACGC-3 ... Matsuoka D, Nanmori T, Sato K, Fukami Y, Kikkawa U & Yasuda T (2002) Activation of AtMEK1, an Arabidopsis mitogen-activated protein kinase kinase, in vitro and in vivo: analysis of active mutants expressed...
- 11
- 700
- 0
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx
... GCGGGATCCGTGAATAATCTGCACCCTCGA ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC ... GCGAAGCTTCACGATGTCTCACACCATTT GCGGGATCCCGTTTCCCAGCCTGTTGGGCCT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC ... GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT...
- 14
- 517
- 0
Báo cáo khoa học: Xenopus Rbm9 is a novel interactor of XGld2 in the cytoplasmic polyadenylation complex pptx
... Nucleic Acids Res 32, 1325– 1334 Nakahata S, Kotani T, Mita K, Kawasaki T, Katsu Y, Nagahama Y & Yamashita M (2003) Involvement of Xenopus Pumilio in the translational regulation that is specific ... compilation ª 2008 FEBS C Papin et al Zealand), followed by affinity purification The antibody against Xenopus CPEB is an affinity-purified rabbit polyclonal antiserum [20] The RPA and AuroraA antibodies ... of regulated mRNAs Although cytoplasmic polyadenylation is regulated by a protein complex at the 3¢-end of the mRNA, PAP is the only known enzyme capable of elongating the poly (A) tail This activity...
- 14
- 502
- 0
Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx
... and a sense cDNA probe (complementary to the antisense) for mouse Slc1 2a2 mRNA were designed as follows; Slc1 2a2 antisense, 5¢-ATCTTCACAAGAAAAAT CACCTGGTACCAAGGATGT; Slc1 2a2 sense, 5¢-ACAT CCTTGGTACCAGGTGATTTTTCTTGTGAAGAT ... genes and connective tissue patterning Development 121, 693–705 16 Ozaki H, Watanabe Y, Takahashi K, Kitamura K, Tanaka A, Urase K, Momoi T, Sudo K, Sakagami J, Asano M et al (2001) Six4, a putative ... Natl Acad Sci USA 95, 14220–14225 Ohto H, Kamada S, Tago K, Tominaga S, Ozaki H, Sato S & Kawakami K (1999) Cooperation of Six and Eya in activation of their target genes through nuclear translocation...
- 16
- 476
- 0
Báo cáo khoa học: "Lexical surprisal as a general predictor of reading time" potx
... statistic indicates the extent to which each surprisal estimate accounts for RT, and can thus serve as a measure of the psychological accuracy of each model However, this kind of analysis assumes ... the ability of lexicalized surprisal to explain a significant amount of variance in RT data for naturalistic texts, over and above that accounted for by other low-level lexical factors, such as ... probabilistic language model Journal of Machine Learning Research, 3:1137–1155 Marisa Ferrara Boston, John Hale, Reinhold Kliegl, Umesh Patil, and Shravan Vasishth 2008 Parsing costs as predictors of reading...
- 11
- 605
- 0
Báo cáo khoa học: Cellulose crystallinity – a key predictor of the enzymatic hydrolysis rate pptx
... showed no impact on the crystallinity of untreated Avicel Multivariate statistical analysis of X-ray data The CrI of cellulose samples was also calculated by quantifying the contribution of amorphous ... C4 carbon signals in NMR analysis could be obtained below a certain degree of crystallinity and within a reasonable acquisition time, so that X-ray diffraction was used as an alternative to map ... result of a dynamic cause that is independent of the adsorption phase (favored enzymatic motion as result of the larger free space available at lower degrees of crystallinity), and is also directly...
- 12
- 554
- 0
Báo cáo khoa học: Insect cytokine, growth-blocking peptide, is a primary regulator of melanin-synthesis enzymes in armyworm larval cuticle pptx
... (5¢-CAGCTGCCCAGAAGAACCGCGAGA TG-3¢, +11 to +36; and 5¢-GAACTCCACGGTGAACC AGT-3¢, +1286 to +1305 bp), DDC-specific primer pair (5¢-ATGGAGGCCGGAGATTTCAAAG-3¢, +1 to +22 bp; and 5¢-ACGGGCTTTAAGTATTTCATCAGGC-3¢, ... cuticle of armyworm larvae Experimental procedures Animals Pseudaletia separata larvae were reared on an artificial diet at 25 ± °C in a photoperiod of 16:8 light ⁄ dark [10] Penultimate instar larvae ... radioactivity was counted in a liquid scintillation counter (Aloka LSC5100, Tokyo, Japan) Cloning and sequence analysis of TH cDNA Total RNA was isolated from integuments of day last instar larvae...
- 10
- 440
- 0
Báo cáo khoa học: Alpha 1-antichymotrypsin/SerpinA3 is a novel target of orphan nuclear receptor Nur77 potx
... pcDNA3.1-GST-Nur77 plasmid pSilencer-shNur77 was prepared by overlapping strategy with primers 5¢-gacGGATCCgcagtccagccatgctccttt caagagaaggagcatg-3¢ (with BamHI), 5¢-cggAAGCTTtATC GATccaaaaaacagtccagccatgctccttctcttg-3¢ ... 5¢-GACTCGCAGACAATGATGG TC-3¢ and 5¢-GCAAACTCATCATGGGCACC-3¢ The results were normalized with b-actin, for which the primers were 5¢-ATGGTGGGAATGGGTCAGAAG-3¢ and 5¢-CA CGCAGCTCATTGTAGAAGG-3¢ Another ... CCTCCAAAAAGCACACAGA-3¢ for St-182 and St-93/ -182, 5¢-AGAAATTATCATCTTTTCCAGTCCGAGA-3¢ for St-93 and St-93/-182, and 5¢-TGGTCTTGAACTCCT CGTGATCTGCCCA-3¢ for Lst-595 pcDNA3.1-Nur77 expression plasmid...
- 14
- 397
- 0
Báo cáo khoa học: A designed curved DNA segment that is a remarkable activator of eukaryotic transcription potx
... TTTTTCAGTCAGTTTTTCAGTCAGTTTTTCAC-3¢ and 5¢-GTGAAAAACTGACTGAAAAACTGACTGAAAAAC TGACTGAAAAACTGA-3¢ were annealed to generate a dsDNA fragment, which we named T4-R¢¢ T4-R¢¢ was inserted into the PmaCI site of pRHC4 ... obtained by annealing oligonucleotides 5¢-GTTTTTCATG TTTTTCATGTTTTTCATGTTTTTCAC-3¢ and 5¢-GTG AAAAACATGAAAAACATGAAAAACATGAAAAAC-3¢, Synthetic oligonucleotides 5¢-TCAGTTTTTCAGTCAG TTTTTCAGTCAGTTTTTCAGTCAGTTTTTCAC-3¢ ... Designed DNA as an activator of transcription N Sumida et al transient transfection assay system, at a specific rotational phase and distance between T4 and the promoter [12] We concluded that T4 formed...
- 12
- 399
- 0
Báo cáo khoa học: Ets-1/ Elk-1 is a critical mediator of dipeptidyl-peptidase III transcription in human glioblastoma cells pdf
... inhibitor of dipeptidyl aminopeptidase III by bacteria J Antibiot (Tokyo) 37, 680–681 Hazato T, Inagaki-Shimamura M, Katayama T & Yamamoto T (1982) Separation and characterization of a dipeptidyl aminopeptidase ... and characterization of an alkaline dipeptide naphthylamidase (Arg–Arg–NAase) of the rat skin Arch Klin Exp Dermatol 236, 267–281 de Bersaques J (1972) Peptidases and naphthylamidases in human ... transcriptase using an antisense DPP-IIIspecific primer AAS-2 (5¢-CTGAGCAGAGCATAGATG TAG-3¢; Fig 1) A poly (A) tail was added to the 3¢-end of the purified cDNA with the help of terminal transferase The...
- 15
- 325
- 0
Báo cáo khoa học: Hepatocyte growth factor activator is a serum activator of single-chain precursor macrophage-stimulating protein potx
... processing of pro-MSP in a dose-dependent manner Immunoblot analysis using an anti-MSP IgG revealed a band of approximately 60 kDa, presumably the a chain of mature MSP (Fig 1A) Generation of a band of ... of approximately 30 kDa, presumably the b chain, was also detected by an anti-His tag IgG (Fig 1A) Cleavage site analysis was performed after separating the products of HGFA cleavage by SDS–PAGE ... surface activator), such as matriptase [9] Matriptase is also a potent activator of pro-HGF/SF [12,30] The second pathway is mediated by humoral activators that are generated in injured tissues...
- 10
- 366
- 0
Báo cáo khoa học: Intermittent hypoxia is a key regulator of cancer cell and endothelial cell interplay in tumours pot
... Hodgkiss RJ, Raleigh JA & van der Kogel AJ (2000) Spatial relationship between hypoxia and the (perfused) vascular network in a human glioma xenograft: a quantitative multi-parameter analysis Int ... enzymes that lead to extracellular matrix degradation (matrix metalloproteases) [75–78] In addition, NF-jB activation was reported as an early event in malignant transformation in vitro [79], and continuous ... R, Lau AW, Hafer LJ, Yaswen P, Stampfer M, Rogers AE et al (2000) Activation of NF-kappaB ⁄ Rel occurs early during neoplastic transformation of mammary cells Carcinogenesis 21, 871–879 Rayet...
- 12
- 390
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25