platform virtualdj offers a wide range of features that brings more creativity to your mixes providing features that will improve your skills and take your dj experience to a whole new level
USAID Supported a Wide Range of Child and Maternal Health Activities, but Lacked Detailed Spending Data and a Proven Method for Sharing Best Practices pptx
... Survival and Maternal Health account in fiscal years 2004 and 2005 helped fund wide- ranging efforts to lower maternal and child mortality in Africa, Asia and the Near East, and Latin America and ... to countries in Africa, Asia and the Near East, and Latin America and the Caribbean and to the Bureau for Global Health In allocating the funds, the agency considered various factors in its annual ... Ethiopia USAID Is Working to Increase Attention to Maternal and Newborn Health USAID has taken several steps to increase attention to maternal and newborn health Specifically, the agency has established...
- 64
- 379
- 0
Báo cáo khoa học: " Development of a novel monoclonal antibody with reactivity to a wide range of Venezuelan equine encephalitis virus strains" docx
... ( 1A4 A-1, 3B 2A- 9 and 1A3 B-7) Humanisation of CUF37- 2a will be essential if this antibody is to find use as an antiviral in humans and these data suggest that CUF37- 2a may be a suitable candidate ... BeAn8 Pixuna CaAr508 AG80 Control Figure Reactivity of phagemid clones to a wide range of VEEV strains Reactivity of phagemid clones to a wide range of VEEV strains Supernatants from phagemid clones, ... into a murine IgG 2a kappa antibody, which was designated CUF37- 2a Murine IgG 2a was chosen as the framework as it has equivalent biological and functional activities to human IgG1 The amino acid...
- 9
- 290
- 0
Tài liệu Managed Investment Funds Product Disclosure Statement - A range of funds that allows you to create an investment portfolio that suits your individual needs ppt
... in New Zealand at a later date during the term of this PDS Applications from outside Australia and New Zealand will not be accepted If Colonial First State elects to make the offer in New Zealand, ... documentation Appoint a financial adviser to transact online on my behalf? By appointing a financial adviser to transact on your behalf, you are giving that adviser, and any person acting on behalf of ... debit arrangement Each of the changes in paragraphs (a) to (f) is a separate right, and this clause A is to be read as if such change was a separately expressed right B Changes to terms and conditions...
- 52
- 577
- 0
Wide Range of Diseases Linked to Pesticides docx
... trigger asthma attacks, but are also a root cause of asthma A landmark 2004 study finds that not only environmental exposures lead to above-average asthma rates among children, but that timing of ... rectum, sinus/nasal, stomach, testicles and thyroid, as well as melanoma (a form of skin cancer), multiple myeloma (cancer of the plasma cells of bone marrow) and neuroblastoma (cancer of the nerve ... examine data from the National Health and Nutrition Examination Survey (NHANES), a program of studies designed to assess the health and nutritional status of adults and children The study shows that...
- 9
- 201
- 0
báo cáo hóa học: " Simulator sickness when performing gaze shifts within a wide field of view optic flow environment: preliminary evidence for using virtual reality in vestibular rehabilitation" pptx
... HMDs to complain of eyestrain, blurred vision, headache, and nausea [30,31] In addition, DiZio and Lackner suggest that wearing an HMD effectively increases the mass and inertia of the head, thereby ... care is taken to minimize delays between head tracking devices and image updates, VR-induced retinal slip can be delivered in a controlled manner in order to cause adaptation A randomized trial ... and accuracy of the head gaze movements with respect to the targets will be the subject of a future report Data Analysis Five dependent variables of interest were examined: SUDS, total SSQ, and...
- 10
- 323
- 0
Báo cáo lâm nghiệp: " On the niche breadth of Fagus sylvatica: soil nutrient status in 50 Central European beech stands on a broad range of bedrock types" potx
... Claystone Sandstone Sandstone Sandstone Sandstone Sandstone Sandstone Sandstone Sandstone Sand Sand Sand Sand Loess Loess Loess Loess Loess Loess Loess Loess Glacial deposit Glacial deposit Glacial deposit ... deposits (Tab I) The soils are mainly Umbrisols (on sands, sandstones, and glacial deposits), Cambisols (on claystones, limestones, and loess), and Leptosols (on sandstones and limestones) in a variety ... geological substrate types in PCA axes and together with chemical variables of mineral soil and organic layer (Nt /Pt ratio, organic matter dry mass and total Ca + Mg + K pool of the organic layer, total...
- 14
- 382
- 0
Báo cáo khoa học: " A geminiviral amplicon (VA) derived from Tomato leaf curl virus (ToLCV) can replicate in a wide variety of plant species and also acts as a VIGS vector" pps
... viral amplicon was found to be generated and replicated in plants like tomato, tobacco (Nicotiana xanthii), Arabidopsis thaliana and rice (Oryza sativa, variety Pusa Basmati) We also show that ... VA(AC2MAC4M)] of VA/ToLCV constructs in tomato plants (A) Total DNA was isolated from the tomato leaves agroinfiltrated with VIGS, VA(AC2M), VA(AC4M) and VA(AC2MAC4M) separately and the release of episome ... cloning in pCAMBIA1391Z vector to generate VA (AC2MAC4M) construct Isolation of PCNA Fragment from Tomato Total RNA was extracted from of Tomato (variety Pusa Ruby) and first strand cDNA made using...
- 13
- 428
- 0
Báo cáo y học: "The EVIDEM framework and its usefulness for priority setting across a broad range of health interventions" docx
... it would lead to decisions that are considered fair and acceptable to stakeholders We agree with this point of view, and see much scope to integrate MCDA and A4 R The A4 R framework has been criticized ... (DCE) questionnaire, an approach that facilitates MDCA, and distributed this among 24 national health policymakers, 55 health professionals, and 163 general populations Third, our DCE analyses resulted ... priority setting across a broad range of health interventions Cost Effectiveness and Resource Allocation 2011 9:8 Submit your next manuscript to BioMed Central and take full advantage of: • Convenient...
- 3
- 276
- 0
Báo cáo y học: "orrection: The EVIDEM framework and its usefulness for priority setting across a broad range of health intervention" pdf
... Program (HITAP), Ministry of Public Health, Nonthaburi, Thailand School of Public Health and Social Sciences-Muhimbili, University of Health and Social Sciences, Tanzania *Corresponding author ... reasonableness, publicity, appeal and enforcement are satisfied, it would lead to decisions that are considered fair and acceptable to stakeholders In our view, exploring how stakeholders' divergent ... EVIDEM framework and its usefulness for priority setting across a broad range of health interventions Cost Effectiveness and Resource Allocation, 2011 9: p Daniels, N., Accountability for reasonableness:...
- 3
- 228
- 0
Báo cáo y học: "MicroRNAs show a wide diversity of expression profiles in the developing and mature central nervous system" docx
... larval zebrafish brain and retina (Figures 1b,e and 2c; Additional data file 7, and Table B in Additional data file 27) whereas miR-138 (Additional data file 11, and Table B in Additional data ... Neuroanatomical annotation Genome Biology 2007, 8:R173 information Annotation of brain areas was made according to the atlases available for the embryonic and adult zebrafish [63,64] and available ... tegmentum; Additional data files 13 and 14, and Tables C and H in Additional data file 27) For example, they are expressed Patterns of miRNA expression can change dramatically between larval and adult...
- 16
- 400
- 0
Tài liệu Báo cáo khoa học: A zymogen form of masquerade-like serine proteinase homologue is cleaved during pro-phenoloxidase activation by Ca2+ in coleopteran and Tenebrio molitor larvae docx
... molecular level This paper describes the purification and cDNA cloning of a 45-kDa protein that acts as a pro-PO activating cofactor in T molitor larvae The deduced amino acid sequence of the 45-kDa ... pro-PO activation reaction MATERIALS AND METHODS Animals, collection of hemolymph and hemocytes T molitor larvae (mealworm) were maintained on a laboratory bench in terraria containing wheat bran ... an affinity-purified antibody raised against the purified 45-kDa Tm-mas A secondary antibody (alkaline phosphatase-conjugated anti-rabbit IgG, Bio-Rad) was used at a dilution of : 1000 Phage DNA...
- 9
- 463
- 0
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx
... (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS 4099 Molecular characterization ... Molecular characterization of ANKHD1 splice variant studies blast searches of VBARP revealed that this protein has homology to human ankyrin repeat and KH domain containing 1(ANKHD1) variants, and to ... Caspases involved in VBARP-mediated cell survival Caspases, a family of cysteine acid proteases, are central regulators of apoptosis [12,13] Caspases are routinely used as a measure of apoptosis,...
- 12
- 561
- 0
A SMALLER HISTORY OF GREECE from the earliest times to the Roman conquest doc
... spring of B.C 490 a large army and fleet were assembled in Cilicia, and the command was given to Datis, a Median, and Artaphernes, son of the satrap of Sardis of that name Warned by the recent disaster ... henceforth to be inhabited by the Achaeans, and to be called after them The Ionians withdrew to Attica, and the greater part of them afterwards emigrated to Asia Minor The Heraclidae and the Dorians ... she took a lively interest in the welfare and glory of her native land, and was animated by an earnest and lofty spirit of patriotism The Spartan mother had reason to be proud of herself and of...
- 233
- 390
- 0
Báo cáo khoa học: Detection and characterization of a novel extracellular fungal enzyme that catalyzes the specific and hydrolytic cleavage of lignin guaiacylglycerol b-aryl ether linkages pdf
... b-aryl ether cleavage activity was measured as described above Localization of b-aryl ether cleavage activity A 14-day-old culture (4 mL) of 2BW-1 cells was separated into supernatant and residue ... Isolation of microorganisms that can cleave b-aryl ether linkages A very sensitive assay was necessary for isolation of microorganisms that can cleave b-aryl ether linkages, so we used guaiacylglycerol ... strongly homologous to that of the ascomycetes, Chaetomium elatum, Podospora anserina, Sordaria fimicola and Neurospora crassa (Fig 2) We had considered that 2BW-1 would be a member of basidiomycetes...
- 10
- 670
- 0
Báo cáo y học: "Vitamin supplementation for prevention of mother-to-child transmission of HIV and pre-term delivery: a systematic review of randomized trial including more than 2800 women" potx
... factorial trial assessing the impact of vitamin A, and of multivitamins excluding Vitamin A, on vertical transmission of HIV-1 and child mortality on pregnant women in Dar es Salaam, Tanzania ... weeks of age, making HIV status undeterminable Multivitamins As described above, the factorial trial of Fawzi et al (2002) [19] performed examined the impact of both vitamin A and multivitamins of ... a different underlying effect for each study and takes between-study variability into consideration as an additional source of variation These effects are assumed to be randomly distributed and...
- 7
- 392
- 0
Báo cáo y học: "A systematic review of the international published literature relating to quality of institutional care for people with longer term mental health problems" potx
... Switzerland and Austria Participants were assigned to the group that most addressed their goal of interest and matched for age, psychopathology, duration of illness and motivation Group and individual ... that warrant the use of seclusion or restraint and provide a clear algorithm are recommended in studies as well as clinical guidance from Canada, New Zealand and Australia, the USA and the UK ... evidence-based practice has been shown to improve staff attitudes towards new practices and increase skills, but many staff not participate in training and those that may lose the skills they have learned...
- 30
- 476
- 0
Báo cáo y học: "Parallel evolution of conserved non-coding elements that target a common set of developmental regulatory genes from worms to humans" doc
... identity to be maintained between the maternal and paternal genomes Remarkably, of the 190 genes that are associated with CNEs in humans and have orthologs in C elegans, 60 have orthologs that are also ... Issue 2, Article R15 Vavouri et al Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ: Gapped BLAST and PSI-BLAST: a new generation of protein database search programs Nucleic ... databases: DBD, a database of computationally predicted transcription factors through homology to known DNA-binding domains [29]; and wTF2.0, a compendium of computationally and manually curated...
- 14
- 257
- 0
A sociological study of tamil entrepreneurship with special reference to up country tamil business in sri lanka
... into collecting valuable data Moreover, Dr Nageshwaran, the Head of the Department of Languages of Sabaragamuwa University of Sri Lanka and Prof Chandrasekaran, Dean of the Faculty of Education ... colleagues Mr Aruna Shantha, Mr Niroshan Vithanage, Ms Shanthi Hemalatha, and Mr Sampath Fernando, Athula Samarakoon and Miss Kalpani come to mind as gracious friends in this adventure I also offer ... mostly by the British planters in tea and coffee estates of Sri Lanka‟s central highland areas such as Badulla, Nuwara Eliya, Kandy, Matale and Rathnapura According to the census of 2001, 855,888 people...
- 252
- 606
- 0
GENOME WIDE SCREEN OF GENES THAT REGULATE LIPID DROPLET DYNAMICS IN SACCHAROMYCES CEREVISIAE
... monoacylglycerol pathway 15 FA ACS Glycerol DHAP Mitochondrion FA ACS G3P FA-CoA GPAT GPAT LPA LPA Ketone AGPAT AGPAT PA PA ER Lumen FA-CoA FA-CoA PG PI CL PAP-1 DAG DGAT PC PE PS LPA DHAP-DH ... monoacylglycerol acyltransferase and diacylglycerol acyltransferase (DGAT) ultimately leads to the formation of TAG sn-1,2-DAG FA-CoA TAG DGAT FA-CoA sn-2-MAG MGAT sn-2,3-DAG FA-CoA TAG DGAT Figure 1-5 TAG ... members of Dr Yang’ lab and Dr Tan’s They created a comfortable laboratory environment, and always kindly provided needed assistance Particularly, I thank Dr Wang Penghua, Ms Chieu Hai Kee, and Ms...
- 199
- 135
- 0
SAVINGS FITNESS: A GUIDE TO YOUR MONEY AND YOUR FINANCIAL FUTURE pdf
... when to rebalance? There are two methods of rebalancing: calendar and conditional Calendar rebalancing means that once a quarter or once a year you will reduce the investments that have gone up and ... retirement A female retiring today at age 65 can expect to live approximately 20 years These are average figures and how long you can expect to live will depend on factors such as your general health and ... There are numerous worksheets and software programs that can help you calculate approximately how much you’ll need to save Professional financial planners and other financial advisers can help as...
- 32
- 466
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25