pharmacodynamics of pyridostigmine bromide use as a pretreatment drug
báo cáo hóa học:" Assessing normative cut points through differential item functioning analysis: An example from the adaptation of the Middlesex Elderly Assessment of Mental State (MEAMS) for use as a cognitive screening test in Turkey" docx
... level of cognitive ability, then age should not influence pass rates RUMM2020 provides both graphical interpretation of DIF, as well as an ANOVA of the residuals Thus this DIF based ANOVA analysis ... pooled data of both the normal and patient groups, data (based on pass-fail for each subtest) were fitted to the Rasch measurement model DIF was found for certain subtests by age and education, ... a novel approach by assuming that pass scores should be adjusted to ensure the absence of DIF by age and education on each subtest Irrespective of distributional aspects associated with age and...
- 8
- 448
- 0
báo cáo hóa học: " Beyond platinum: synthesis, characterization, and in vitro toxicity of Cu(II)-releasing polymer nanoparticles for potential use as a drug delivery vector" ppt
... ligand concentration on the rate of Cu release, which was actually faster at pH compared to pH This can be explained by looking at the various protonation states of citrate as a function of pH ... Release of Cu under various reaction conditions (A) Initial release data simulating endosome/lysosome pH conditions, (B) release as a function of buffering species, (C) release as a function of added ... Elemental analysis Copper loading A 3-mL aliquot of the nanoparticle solution was adjusted to a pH of using NaOH followed by the addition of copper sulfate in a 1:1 molar ratio with amount of NaOH added...
- 10
- 495
- 0
Báo cáo y học: " Cystitis due to the use of ketamine as a recreational drug: a case report" pot
... urine analysis and urine cytology were negative and a urine culture was sterile An ultrasound examination revealed a thickened bladder wall and a small bladder capacity but normal kidneys Cystoscopy ... ketamine is being used increasingly as a recreational drug we expect ketamine-associated cystitis to become more prevalent in young adults Health care workers should be aware of the problem and ... consent was obtained from the patient for publication of this case report and any accompanying images A copy of the written consent is available for review by the Editor-in-Chief of this journal Table...
- 3
- 391
- 0
Báo cáo y học: " Use of a Javid™ shunt in the management of axillary artery injury as a complication of fracture of the surgical neck of the humerus: a case report" ppsx
... 38:175-184 Husain AK, Khandeparkar JM, Tendolkar AG, Magotra RA, Parulkar GB: Temporary intravascular shunts for peripheral vascular trauma J Postgrad Med 1992, 38(2):68-69 Sriussadaporn S, Pak-art R: ... behalf of the East of Scotland Vascular Network References Yagubyan M, Panneton JM: Axillary artery injury from humeral neck fracture: A rare but disabling traumatic event Vasc Endovascular Surgery ... SD, Rasmussen TE, Goff JM, Johnson CA, Galgon RE, Sarac TP, Rich NM: Contemporary management of wartime vascular trauma J Vasc Surg 2005, 41(4):638-644 Clouse WD, Rasmussen TE, Peck MA, Eliason...
- 4
- 342
- 0
Báo cáo khoa học: "Cystatin C: unsuited to use as a marker of kidney function in the intensive care unit" pot
... issue are warranted Competing interests The author(s) declare that they have no competing interests References 532 Villa P, Jiménez M, Soriano MC, Manzanares J, Casasnovas P: Serum cystatin C as a ... filtration rate in renal transplant recipients Clin Chem 1999, 49:1866-1868 Coll E, Botey A, Alvarez L, Poch E, Quintó LI, Taurina A, Vera M, Piera C, Darnell A: Serum cystatin C as a new marker ... as a marker of acute renal dysfunction in critically ill patients Crit Care 2005, 9:R139-R143 O’Riordan SE, Webb MC, Stowe HJ, Simpson DE, Kandarpa M, Coakly AJ, Newman DJ, Saunders JA, Lamb EJ:...
- 2
- 297
- 0
Báo cáo sinh học: "Use of the score test as a goodness-of-fit measure of the covariance structure in genetic analysis of longitudinal data" ppt
... sub-diagonals and D is a diagonal matrix of the inverse of innovation variances Score and information matrices for D and L parameters can be calculated as functions of the rst and second derivatives ... statistic can also be decomposed to check the parametric assumptions on innovation variances and antedependence parameters For the genetic part of Model 10, the innovation variance was assumed quadratic, ... the t of the environmental covariance was obtained when relaxing the assumption of constant residual variance, and was clearly shown in the score statistic values A much simpler model was chosen...
- 14
- 324
- 0
A study of using english songs as a type of supplementary material in teaching listening for first year non major students of english at phuong dong university
... test was within fifteen minutes During the test, the teacher worked as a cassette player and examiner The marking was done with the same way of assessment and then was analyzed in turn The class ... years; teachers and researchers believe that motivation plays an important part in the process of acquiring an additional language because motivated students are usually those who participate actively ... for this task must have quite easy language and sung at a low speed such as ‘ whatever will be will be’ To carry out this task, teacher can omit some passage of the song word and then ask students...
- 39
- 1,125
- 3
Tài liệu The Value of the Case Study as a Research Strategy doc
... especially adamant that a case database be created and maintained to \allow repetition and re-evaluation of cases Reliability is most important during the data collection phase, and involves the use ... process of preparation, and has summarized major criticisms An epistemological base for analyzing the value of case study research programmes has been ruled out as a major threat because of inconsistencies ... in an Administrative Science Quarterly article titled 'Qualitative data as an attractive nuisance' that research based upon case study was unlikely to transcend story-telling Is case study a valid...
- 15
- 587
- 0
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx
... A1 , hnRNP E1 ⁄ E2 hnRNP A1 ASF ⁄ SF2 hnRNP A1 UUAGGACAUAUAGUUAGCCCUAGG unknown UGGGU CUAGACUAGA CCAGUAGAUCCUAGACUAGA GAAGAAGCGGAGACAGCGACGAAGA AGAUCCAUUCGAUUAG unknown UAGUGAAUAGAGUUAGGCAGGGA ... cells Proc Natl Acad Sci USA 91, 7311–7315 32 Kamata M, Nitahara-Kasahara Y, Miyamoto Y, Yoneda Y & Aida Y (2005) Importin-alpha promotes passage through the nuclear pore complex of human immunodeficiency ... coactivators J Virol 76, 9724–9734 HIV-1 alternative splicing regulation 34 Kuramitsu M, Hashizume C, Yamamoto N, Azuma A, Kamata M, Yamamoto N, Tanaka Y & Aida Y (2005) A novel role for Vpr of...
- 10
- 434
- 0
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt
... AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGGGACACGATGC CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA ... ACAGCAAAAAGGAGGCCAAA GCCACAATCCAGTCATTCCA GATAAGCTTGTGGAAGTCGCGT TCTCACTGGCCCTAAACTGG CTGATAGGGGTTGGGTGATG GCATTTCCATTTCCCTAAGCAC CAACACAATCCTGAGGCACA TCCCTTTGCCTCCTGTTGTT GTACTTGCGCTCAGGAGGAG 178 246 ... BCRP CA9 BMP2 MT 2A CD237904 AL707095 AK095731 DKK1 BC037851 b-Actin GAAGAAGGGCCAGACGC CCTTCGCTGAGTTCCTGC ACATCAGCGGATACTACAGAG TTTGAATGGGCGAGTGATTG CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA...
- 13
- 563
- 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
... hyperphosphorylation occurs because of an imbalance in the activity of tau kinases and phosphatases [3] One particular tau kinase pertinent to metal dyshomeostasis in AD is glycogen synthase kinase-3 ... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors ... decreased availability of intracellular Cu [83] and up-regulated by increased availability of Cu [84] Collectively, these data present a strong case for the native role of APP ⁄ Ab in regulating...
- 9
- 634
- 0
a study on impacts and effectiveness of abc costing method as a cost effective measurement in coal industry
... are classified as variable costs today such as: direct labor, direct materials, and manufacturing overhead All of these will be divided equally based on some fixed criteria such as direct labor ... to access various sources of information nowadays Manual works in manufacturing has a negative relation with the number of machines that are equipped in factories For example, in the past, a car ... of plants are trying to broaden their capacity each year Generally, small companies not have so many capitals as a result; they can not expand their capacity With such kind of this company, adopting...
- 64
- 512
- 0
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt
... Chloroplast DNA Cyanidium caldarium Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana Nuclear DNA Chloroplast DNA Odontella sinensis Chloroplast DNA Prasinophyceae Mesostigma viride ... Chloroplast DNA Euglenophyceae Euglena gracilis Chloroplast DNA Chlorophyceae (green algae) Chlamydomonas reinhardtii Nuclear DNA Chloroplast DNA Higher plant Oryza sativa Nuclear DNA Chloroplast DNA ... found in a primitive green alga, P parkeae as well as E garcilis, C reinhardtii and spinach in the present immunological assays Experimental procedures Preparation of antibodies against various...
- 11
- 501
- 0
báo cáo hóa học:" The validity of self-rated health as a measure of health status among young military personnel: evidence from a cross-sectional survey" pot
... summary, a single-item self-assessment of health was consistently related to a variety of health parameters important to the military Used at a population level, this brief health status measure may ... status and discharge from the military Smoking status at the one-year follow up was assessed using a 7-day point prevalence analysis [16] Discharge was assessed both after BMT and after technical ... impact interventions focused on health behaviors and behavioral intentions have on overall self rated health It is possible that overall self rated health status may serve as a viable measure of...
- 9
- 301
- 0
Báo cáo hóa học: " Biofabrication of Anisotropic Gold Nanotriangles Using Extract of Endophytic Aspergillus clavatus as a Dual Functional Reductant and Stabilizer" potx
... Vigneshwaran N, Ashtaputre NM, Varadarajan PV, Nachane RP, Paralikar KM, Balasubramanya RH: Mat Lett 2007, 61:1413 17 Bhainsa KC, D’Souza SF: Coll Surf B Biointer 2006, 47:160 18 Shankar SS, Ahmad A, ... Cite this article as: Verma et al.: Biofabrication of Anisotropic Gold Nanotriangles Using Extract of Endophytic Aspergillus clavatus as a Dual Functional Reductant and Stabilizer Nanoscale Res ... University, Varanasi 221005, India 2School of Material Science and Technology, Institute of Technology, Banaras Hindu University, Varanasi 221005, India 3National Facility for Tribal and Herbal Medicine,...
- 7
- 261
- 0
Báo cáo khoa học: "Alteration of nitrergic neuromuscular transmission as a result of acute experimental colitis in rat" pot
... :2 esahP gnilpmas fo yad emas eht no deyassa dna ,C°02− ni derots erew selpmas amsalp ehT amsalp eht etarapes ot g × 005,1 yletamixorppa ta nim 51 rof degufirtnec saw elpmas hcae ,noitcelloc ... dohtem yassa lacigoloiborcim a gnisu denimreted erew snoitartnecnoc emipefec amsalp ehT o dohtem lacitylanA esahp ni sa demrofrep erew serudecorp gnilpmas eht dna esod emas eht ta ylralucsumartni ... retfa dna erofeb stibbar ni noitartsinimda ralucsumartni retfa emipefec fo atad emit-noitartnecnoc amsalp naem eht swohs elbaT lm/gµ 002 ot 1.0 fo segnar noitartnecnoc eht nihtiw raenil saw amsalp...
- 5
- 205
- 0
Báo cáo khoa học: "Bony metastases from breast cancer - a study of foetal antigen 2 as a blood tumour markerl" doc
... patients with both skeletal and extra-skeletal metastases FA-2 Assays The serum samples were transported at -20°C to the Williamson Laboratory at St Bartholomew's Hospital FA-2 radioimmunoassays ... metastases These preliminary data point out that FA-2 is a potential helpful blood marker for bony metastases from breast cancer It would therefore appear that serum FA-2 measurement may be useful ... repeated as required The use of blood tumour markers is most established in the diagnosis and monitoring of symptomatic metastatic disease In the diagnosis of metastatic breast Table 1: Mean Values of...
- 4
- 286
- 0
Báo cáo y học: "Identification of a SmD3 epitope with a single symmetrical dimethylation of an arginine residue as a specific target of a subpopulation of anti-Sm antibodies" ppsx
... epitopes assay Assay performance characteristics of the anti-SmD3 peptide (SMP) assay (a) Intra-assay and interassay variability, (b) linearity, and (c) receiver operating characteristic analysis ... peptide-based assay (99.8%; data not shown) Further studies are in progress to compare the assay performance of the anti-SMP assay with that of other commercially available anti-Sm immunoassays For ... high-performance liquid chromatography The molecular mass was found to be 1708.1 Da (average; Precision and reproducibility Measurements of imprecision (interassay and intra-assay variability) were taken...
- 11
- 593
- 0
báo cáo khoa học: "Malignant fibrous histiocytoma of the urinary bladder as a post-radiation secondary cancer: a case report" pdf
... Beltrán A, Prieto Castro R, Regueiro López JC, Leva Vallejo M, Alameda Aragoneses V, Blanco Espinosa A, Moreno Arcas P, Requena Tapia MJ: Malignant fibrohistiocytoma of the bladder [in Spanish] Actas ... found sarcomatoid components in high-grade urothelial carcinomas, and limited clinical information available From gross pathological examination, the mass was obviously unlikely for carcinomas, as ... pelvic cavity at the levels of the neoplasm was detected at the L5 spine level, and palliative radiation therapy in that area was suggested Despite aggressive surgical treatment along with adjuvant...
- 6
- 493
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25