ph or ionic strength of antigen retrieval solution a potential role for refolding during heat treatment
Báo cáo y học: "Identification of possible candidate genes regulating Sjögren''''s syndrome-associated autoimmunity: a potential role for TNFSF4 in autoimmune exocrinopathy" docx
... secretagogue The volume of each saliva sample was measured The saliva samples were then frozen at -80°C until analyzed Statistical analyses For this study, we have standardized both saliva and tear ... design of the study, ANA staining, saliva collections, data analyses, and manuscript preparation All authors read and approved the final manuscript Proposed genetic predisposition for and fatty acid ... generated by GraphPad InStat software (GraphPad Software, Inc., San Diego, CA, USA) A two-tailed P value of less than 0.05 was considered significant Histology Male and female C57BL/6.NOD-Aec1Aec2R(n)...
- 12
- 399
- 0
Báo cáo y học: "Breakdown of accommodation in nerve: a possible role for persistent sodium current" potx
... obtaining a value for internodal leak resistance on the basis of experimental data alone For these reasons we believe that the present approach was justified Alternative explanations of breakdown ... was based on studies on the morphology of cat ventral spinal roots The geometrical parameters were taken from cats of 1–11 years of age for a motor nerve fiber with a diameter of 14 µm (see Table ... time-constant was slowed by a factor of two (timeconstant); and c) the kinetics was displaced so that the channel was activated at a membrane potential 20 mV more negative than is required to activate the...
- 11
- 262
- 0
Assessment of pretreatments and enzymatic hydrolysis of wheat straw as a sugar source for bioprocess industry
... evaluate cellulose dissolution pretreatments such as ionic liquids and phosphoric acid pretreatment as they offer greater potential at biomass fractionation and superior kinetic advantages for ... fragments and acetyl groups are removed forming acetic acid Organic solvent such as acetone can be used to precipitate and separate the fractionated biomass The pretreatment has an advantage of ... beta allomorph with 40% crystallinity [28] Low crystallinity of wheat straw cellulose makes it a good substrate for enzymatic saccharification [25] as well as a suitable host polymer for preparation...
- 20
- 437
- 0
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf
... precultured for 12 h under normoxia or hypoxia before addition of actinomycin D The half-life of HO-1 mRNA in YN-1 cells was about 9.5 h under normoxia, and remained Functional analysis of the HO-1 and ... We thank S Taketani for anti-HO-1 and Y FujiiKuriyama for the HRE constructs This study was supported by Grants-in-aid for Scientific Research (B), for Scientific Research on Priority Areas, and ... Functional analysis of cDNAs for two types of human heme oxygenase and evidence for their separate regulation J Biochem (Tokyo) 113, 214–218 Takeda K, Ishizawa S, Sato M, Yoshida T & Shibahara S...
- 12
- 621
- 0
Tài liệu Báo cáo khoa học: The most C-terminal tri-glycine segment within the polyglycine stretch of the pea Toc75 transit peptide plays a critical role for targeting the protein to the chloroplast outer envelope membrane ppt
... ****AAA*** *******AAA ****AAAAAA AAA****AAA AAA*AAA*** *******DDD *******EEE *******LLL *******NNN *******SSS *******PPP chloroplasts used for this assay [15] Furthermore, the intermediate and mature ... precursor was sorted to multiple pathways in a way distinct from that of AGA precursor, or (c) the effect of AAG mutation on correct targeting was significantly less than that of AGA mutation Taken ... the pea Toc75 transit peptide and its derivatives used in this study Name Sequence (residues 91–100) WT polyAla AGG GAG GGA GAA AGA AAG GGD GGE GGL GGN GGS GGP GGGAGGGGGG *SA*AAAAA* AAA*******...
- 9
- 496
- 0
Tài liệu AMAZONIAN ACCESSIONS OF WILD HEVEA GERMPLASM - A POTENTIAL SOURCE OF DROUGHT TOLERANCE pptx
... Tarauaca, Xapuri Rondonia – Ariquemes, Calama, Costa Marques, Jiparana, Ouro Preto, Pimenta Bueno, Jaru Mato Grosso: Aracotuba, Cartriquaca, Itauba, Vila Bella Provenance-wise conservation- India Introduced ... months in a year - average annual rain fall of 7.5mm per day - average of 90 rainy days/ year 18 First year post- drought data on range and mean of growth characters in the hot-spot region Characters ... the availability of sufficient genetic variability 1981-IRRDB germplasm collection – a valuable reservoir of genes for various abiotic stresses Acre : Brasileia, Feijo, Sena Madureira, Tarauaca,...
- 23
- 573
- 0
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt
... pseudonana Nuclear DNA Chloroplast DNA Odontella sinensis Chloroplast DNA Prasinophyceae Mesostigma viride Chloroplast DNA Euglenophyceae Euglena gracilis Chloroplast DNA Chlorophyceae (green algae) ... little information on the extrinsic proteins of non-green algae including the Glaucophyceae, Haptophyceae, Prasinophyceae, Bacillarriophyceae (diatom) and Phaeophyceae (brown algae), which are considered ... Cyanobacteria Synechocystis sp PCC6803 Rhodophyceae (red algae) Cyanidioschyzon merolae Nuclear DNA Chloroplast DNA Cyanidium caldarium Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana...
- 11
- 501
- 0
Evaluation of Demonstration Test Results of Alternative Technologies for Demilitarization of Assembled Chemical Weapons A Supplemental Review for Demonstration II pptx
... approval has been granted, a 3X material may be shipped to an approved hazardous waste treatment facility for disposal in a landfill or for further treatment 5X level Treatment of solids to a ... president of the National Academy of Sciences The National Academy of Engineering was established in 1964, under the charter of the National Academy of Sciences, as a parallel organization of outstanding ... SOURCE: AEA (2000) 16 ALTERNATIVE TECHNOLOGIES FOR DEMILITARIZATION OF ASSEMBLED CHEMICAL WEAPONS balance for carbon Organic sulfur and phosphorus were determined from analysis of the sulfate and phosphate...
- 66
- 380
- 0
Báo cáo Y học: The a1b1 contact of human hemoglobin plays a key role in stabilizing the bound dioxygen Further evidence from the iron valency hybrids potx
... buer used was Mes for pH 6.2 and Caps for pH 9.2 these computations, the initial value for each of the rate constants was taken from the corresponding slope of a biphasic curve (as delineated in ... state of the run was not for the usual acidic met-form but for an admixture with hemichrome For the oxidation product of separated b chains, we have already carried out 8K EPR analysis in 10 mM maleate ... tetrameric form (99%) was for the b chain This estimation was made on the basis of the results by McDonald et al [16] In a previous paper [8], we have reported that the separated a and b chains are...
- 10
- 648
- 0
the handbook of patient safety compliance a practical guide for
... potential harm from embracing a standardized taxonomy of terms and data aggregation for patient safety Working with legal counsel, risk management, and health information professionals, senior ... against nurses for serious errors The case of Betsy Lehman was emblematic of this approach In the aftermath of a catastrophic medication error at Dana Farber Cancer Institute, detailed evaluations ... HANDBOOK OF PATIENT SAFETY COMPLIANCE Y THE HANDBOOK OF PATIENT SAFETY COMPLIANCE A Practical Guide for Health Care Organizations Fay A Rozovsky and James R Woods Jr., Editors Foreword by Maree...
- 289
- 339
- 0
Báo cáo hóa học: "Distress or no distress, that''''s the question: A cutoff point for distress in a working population" pptx
... 8.2% for males and 6.2% and 10% for females [16] For the recognition, prevention and treatment of mental health problems, the underestimation of distress can be regarded as unfavorable for several ... helpful for the identification – and maybe even monitoring – of employees at risk for sickness absence and for the selection of cases for support like stress management programs or treatment in order ... of Health and Human Services; 2001 Australian Institute of Health and Welfare and Commonwealth Department of Health and Family Services: First report on national health priority areas 1996 Canberra:...
- 8
- 396
- 0
Báo cáo y học: "Fat-Storing Multilocular Cells Expressing CCR5 Increase in the Thymus with Advancing Age: Potential Role for CCR5 Ligands on the Differentiation and Migration of Preadipocytes" pot
... signal intensity for each cDNA was examined using the Array Pro software (Media Cybernetics, Silver Spring, MD) Background correction for each cDNA microarray hybridization assay was assessed via ... Dr Alan Sher and Andre Bafica from NIAID for kindly providing the aged CCR5-deficient mice for certain studies and Prof Dr Radovan Borojevic for valuable discussions on this work This work was ... "Guide for the Care and Use of Laboratory Animals" [NIH publication no 86-23, 1985] CCR5-deficient mice (B6;129P2-Ccr5tm1Kuz/J) originally obtained from Jackson Laboratories (Bar Harbor, ME) were aged...
- 14
- 421
- 0
Báo cáo y học: "Fluvoxamine for aripiprazole-associated akathisia in patients with schizophrenia: a potential role of sigma-1 receptors" ppt
... using larger samples should be performed to clarify the role of sigma-1 receptors in the efficacy of fluvoxamine for akathisia Author details Department of Psychiatry, Asahikawa Red Cross Hospital, ... with antipsychotic treatment Aripiprazole is an antipsychotic drug that acts as a partial agonist at dopamine D receptors and serotonin 5hydroxytryptamine (5-HT) 1A receptors, and an antagonist at ... aripiprazoleassociated akathisia in patients with schizophrenia: a potential role of sigma-1 receptors Annals of General Psychiatry 2010 9:11 Submit your next manuscript to BioMed Central and take full advantage...
- 3
- 403
- 0
Báo cáo y học: "Complement C3 serum levels in anorexia nervosa: a potential biomarker for the severity of disease" pdf
... concentrations between cohorts using Wilcoxon rank sum test Data are expressed as median (interquartile range) b Laboratory samples were unavailable for one patient for C 5a and CH50, nine controls for ... the power of our statistical analysis and make our data vulnerable to a statistical type II error Therefore, our data not allow for advocating complement serum levels as a new biomarker until ... stability draw from a combination of factors including improvement of standard laboratory values, ingestion of adequate calories to begin weight restoration, and resolution of comorbidities [4,10,11]...
- 6
- 441
- 0
Báo cáo y học: "A proinflammatory role for Fas in joints of mice with collagen-induced arthritis" docx
... instructions Anticollagen antibody assay Sera were collected from control DBA-lpr/+ and mutant DBA-lpr/lpr mice before immunization and at days 20 and 47 after immunization and a standard ELISA was used ... 1:20,000 was added and incubated for hour at 37°C This step was followed by washing and incubation with a 1:1000 dilution of alkalinephosphatase-conjugated streptavidin (Dianova) Plates were ... samples were heated for hours at 42°C and rapidly cooled on ice TaqMan® Real-Time PCR The TaqMan® PCR Core Reagent Kit (Applied Biosystems, Weiterstadt, Germany) was used for amplification of...
- 11
- 469
- 0
Báo cáo y học: "tatin-induced expression of CD59 on vascular endothelium in hypoxia: a potential mechanism for the anti-inflammatory actions of statins in rheumatoid arthritis" pptx
... presence (At) or absence of atorvastatin 0.25 μM Total RNA was isolated, and northern blots were prepared and probed for CD59 mRNA atorvastatin (Figure 4b) Further experiments using quantitative real-time ... by atorvastatin and the hypoxia of CD59 (P < 0.05) Analysis of the effects of statins on NO bioavailability has suggested that the isoprenoid intermediates geranylgeranyl pyrophosphate and geranylgeraniol, ... 50:4051-4059 Barsante MM, Roffe E, Yokoro CM, Tafuri WL, Souza DG, Pinho V, Castro MSD, Teixeira MM: Anti-inflammatory and analgesic effects of atorvastatin in a rat model of adjuvant-induced arthritis...
- 12
- 510
- 0
Báo cáo khoa học: " Investigation of tumor hypoxia using a twoenzyme system for in vitro generation of oxygen deficiency" pot
... two-class t-tests and GOanalysis Pathway analysis was performed based on information available on cellular signalling processes from a curated database on signalling networks and systems biology package ... was also performed for RNA isolated from cells incubated for the same time period (24 h) under normoxic conditions For bioinformatical-analysis a step-wise approach was applied: Weak signals, ... proportion of vital cells after irradiation, compared to the non-irradiated control was calculated Statistical analysis Statistical analysis of the genomics was performed with SUMO (Christian...
- 12
- 306
- 0
Báo cáo y học: "Extracellular localization of galectin-3 has a deleterious role in joint tissues" docx
... MMP-3 S: GAAAGTCTGGGAAGAGGTGACTCCAC AS: CAGTGTTGGCTGAGTGAAAGAGACCC 284 Osteocalcin S: CATGAGAGCCCTCACA AS: AGAGCGACACCCTAGAC 310 Alkaline phosphatase S: TGCAGTACGAGCTGAACAG AS: TGAAGACGTGGGAATGGTC ... score for mice four days after intra-articular galectin-3 (gal3) injection (a) Total score, (b) cartilage score and (c) bone histomorphometric score Data are expressed as median and (range) and are ... during OA, and particularly during inflammatory phases Very often, these phases lead to hyperplasia of the synovium, which may invade the joint space and adhere to cartilage, generating a pannus...
- 9
- 351
- 0
Báo cáo y học: "Three-dimensional and thermal surface imaging produces reliable measures of joint shape and temperature: a potential tool for quantifying arthritis" pdf
... Maldonado-Cocco J, Orozco-Alcala J, Prieur AM, Suarez-Almazor ME, Woo P, International League of Associations for Rheumatology: International League of Associations for Rheumatology classification ... purposes) Arthritis Research & Therapy Vol 10 No Spalding et al Table Reproducibility of wrist and metacarpalphalangeal three-dimensional measures across sessions 3D measure Wrist Metacarpophalangeal ... the effect of significant deformity on this approach in a larger population of RA and JIA patients Ultimately, this approach may provide a tool to improve the accuracy of assessment of arthritis...
- 9
- 344
- 0
Báo cáo y học: " Is distortion of the bioprosthesis ring a risk factor for early calcificatio" docx
... this article as: Cereijo et al.: Is distortion of the bioprosthesis ring a risk factor for early calcification? Journal of Cardiothoracic Surgery 2010 5:77 Author details Department of Cardiovascular ... Cereijo et al Journal of Cardiothoracic Surgery 2010, 5:77 http://www.cardiothoracicsurgery.org/content/5/1/77 Page of Table Demographic data Age (range) Female/Male Aortic Stenosis Renal insufficiency ... Cardiovascular Surgery, Santiago de Compostela University Hospital La Choupana, Santiago de Compostela 15706, Spain 2Department of Radiology, Santiago de Compostela University Hospital La Choupana, Santiago...
- 3
- 370
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25