pgs gags and bone remodeling a complex dysregulation of the anabolic catabolic balance
Báo cáo y học: "(Sub)clinical cardiovascular disease is associated with increased bone loss and fracture risk; a systematic review of the association between cardiovascular disease and osteoporosis" ppsx
... drafted the manuscript LT participated in interpretation and analysis of the data and helped to draft the manuscript WL conceived of the Page 15 of 19 hypothesis of the manuscript and participated ... Research Institute/Reade, Dr Jan van Breemenstraat 2, 1056 AB Amsterdam, The Netherlands Authors’ contributions DU conducted the data collection, interpretation and analysis of the data and drafted ... Therapy 2011, 13:R5 http://arthritis-research.com/content/13/1/R5 60 Sumino H, Ichikawa S, Kasama S, Takahashi T, Kumakura H, Takayama Y, Kanda T, Sakamaki T, Kurabayashi M: Elevated arterial...
- 19
- 500
- 0
Tài liệu Báo cáo khoa học: Endogenous expression and protein kinase A-dependent phosphorylation of the guanine nucleotide exchange factor Ras-GRF1 in human embryonic kidney 293 cells pptx
... ON357, 5¢-TGAAACATCACCAACTAAATC TCCAA-3¢; ON358, 5¢-GACGACTCCATTGTTATAGG AAAAGAGT-3¢; ON359, 5¢-GCCGCTGGAGAAACAG CAT-3¢; ON360, 5¢-GCCACCCATTCGTCACAATC-3¢; and ON361, 5¢-ATGCAGAAGGGGATCCGG-3¢ Phospho-ERK1 ... cleared by centrifugation (13 000 g at °C) and the protein concentrations in the supernatants were quantified by the BC assay quantification kit (Uptima) using BSA as the standard Equal amounts of ... towards Ras Ras-GRF1 mediates activation of Ras subsequent to the stimulation of Gi- and Gqcoupled receptors [8,9] The main mechanism for the activation of RasGRF1 is the binding of Ca2+ ⁄ CaM...
- 13
- 730
- 0
A SYSTEM OF LOGIC, RATIOCINATIVE AND INDUCTIVE, BEING A CONNECTED VIEW OF THE PRINCIPLES OF EVIDENCE, AND THE METHODS OF SCIENTIFIC INVESTIGATION pdf
... cut the matter short by saying, two ideas They would say, that the subject and predicate are both of them names of ideas; the idea of gold, for instance, and the idea of yellow; and that what takes ... conception, and the like? Probably all these would have been placed by the Aristotelian school in the categories of actio and passio; and the relation of such of them as are active, to their objects, and ... White, also, is a name of a thing, or rather of things Whiteness, again, is the name of a quality or attribute of those things Man is a name of many things; humanity is a name of an attribute of...
- 1,048
- 548
- 0
HYGIENIC PHYSIOLOGY WITH SPECIAL REFERENCE TO THE USE OF ALCOHOLIC DRINKS AND NARCOTICS BEING A REVISED EDITION OF THE FOURTEEN WEEKS IN HUMAN PHYSIOLOGY ppt
... being weary."] The muscles are nearly all arranged in pairs, each with its antagonist, so that, as they contract and expand alternately, the bone to which they are attached is moved to and fro ... Table of 206 bones is exclusive of the sesamoid bones which occur in pairs at the roots of the thumb and great toe, making 214 as given by Leidy and Draper Gray omits the bones of the ear, and ... parts are the _tarsus_, the _metatarsus_, and the _phalanges_ The graceful arch of the foot, and the numerous bones joined by cartilages, give an elasticity to the step that could never be attained...
- 532
- 562
- 0
The Rise and Fall of the U.S. Mortgage and Credit Markets: A Comprehensive Analysis of the Meltdown pot
... Buildup and Meltdown of the Mortgage and Credit Markets The demand for residential real estate was seemingly insatiable After rising at an average annual rate of slightly less than percent during the ... excess of that amount is shared by the government (90%) and Citigroup (10%) Guarantee a portion of an asset pool of loans and securities backed by residential and commercial real estate and other ... of the appreciated value of the collateral property The share of the appreciated value is determined and due at the sale of the property or at the termination of the mortgage In addition to promoting...
- 51
- 467
- 0
NEEDS AND PROBLEMS IN ENGLISH LISTENING AND SPEAKING SKILLS: A CASE STUDY OF THE METROPOLITAN POLICE OFFICERS AT COUNTER SERVICE AT CHANA SONGKRAM POLICE STATION pot
... elements are further defined below 1) Language Data Learners need samples of listening and speaking language Learners can access to appropriate samples of oral language in contexts that make transparent ... and is also fundamental for planning of any language courses The aims of ESP are to meet the needs of particular learners As Robinson (1980) states, an ESP course is purposeful and aimed at the ... already in order to decide which of the necessities the learner lacks Lacks are what the learners already know that are the gaps between the target proficiency and the existing proficiency of the...
- 100
- 1,311
- 5
báo cáo khoa học: "Implementing health research through academic and clinical partnerships: a realistic evaluation of the Collaborations for Leadership in Applied Health Research and Care (CLAHRC)" pot
... the potential and actual impacts of findings within CLAHRCs through recording and observations of these meetings, and the maintenance of an evaluation team critical event diary We will take a ... research and infrastructure aimed at increasing our capability and capacity to maximise the impact of health research [5] The group also recommended that implementation researchers and implementation ... judgement The purpose of the evaluation is formative, focusing on processes and a range of potential and actual impacts from implementation and use of knowledge as they occur over the lifespan of the...
- 12
- 389
- 0
Báo cáo y học: "Emergency Department Triage Scales and Their Components: A Systematic Review of the Scientific Evidence" pptx
... most of the triage scales developed in the 1990s and 2000s being designed as 5-level scales Of these, the Australian Triage Scale (ATS), Canadian Emergency Department Triage and Acuity Scale (CTAS), ... clear, internal validity is good while sample size is of uncertain adequacy ATS = Australasian Triage Scale; CTAS = Canadian Emergency Department Triage and Acuity Scale; MTS = Manchester Triage ... but many patients All studies are observational triage levels, we could not evaluate the validity of the triage scales across all triage levels as regards the risk of early death To estimate the...
- 13
- 488
- 0
Chinese multinational construction firms in international and domestic markets a re examination of the eclectic paradigm
... terms of case studies, are fundamental to the understanding of the dynamics of organizational life and to the development and testing of theories of organizational adaptation, change, innovation and ... nations Analysis and statistical processing Identify the significance of the advantages and factors, analyze their relationship Explain and analyze Chinese CMNCs' activities in international market ... significance of advantages and factors, analyze their relationship Explain and analyze Chinese CMNCs' activities in domestic market Findings: Through the analysis of Chinese CMNCs' advantages and factors...
- 466
- 559
- 0
Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx
... 5¢-GCAGCAUCUUUAAUGAAUAdTdT-3¢ and 5¢-AUAAGUAAUUUCUACGACG dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ (siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢ and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ ... CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA GGATA-3¢ and 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3¢) were annealed and inserted into the BglII and HindIII sites of pEGFP-NLS The oligonucleotide ... GDP, across the nuclear envelope regulates the binding and release of cargo by transport factors RanGTP is abundant in the nucleus as a result of the activity of RCC1, a guanine nucleotide exchange...
- 12
- 454
- 0
Coral Reef Fishes: Dynamics and Diversity in a Complex Ecosystem ppt
... Oplegnathidae (Cione et al., 1994)] The complete separation of Gondwanan fragments, with the opening of the Australian-Antarctic seaway and the Drake Passage between Antarctica and South America, ... Cheilodactylidae, Labridae, Sciaenidae, and Sparidae (Wilson and Allen, 1987) The relative importance of vicariance associated with Gondwanan fragmentation and dispersal via the west wind drift remains ... regional (East Pacific/Caribbean) endemics, the Chaenopsidae and Labrisomidae Many of the characteristic reef fish families (e.g., Labridae, Pomacentridae) are present and abundant in New Zealand,...
- 555
- 332
- 0
Báo cáo Y học: Dietary bisphenol A prevents ovarian degeneration and bone loss in female mice lacking the aromatase gene (Cyp19 ) pptx
... Sigma-Aldrich An ELISA kit for BPA was from Takeda Pharmaceutical Co Ltd (Tokyo, Japan) All other chemicals were of analytical grade Animals Animal care and experiments were carried out in accordance ... 5¢-AGCTTGTTGACACGCTTCAGT TTGT-3¢ and antisense primer: 5¢-GTAACACGATCAG GGGACGATGACG-3¢), IGF-I receptor (a 1387-bp fragment with sense primer: 5¢-GGGGCCAAACTCAA CCGTCTAAAC-3¢ and antisense primer:CGTAAGGC ... primer:CGTAAGGC TGTCTCTCATCAAAACT-3¢), bone morphogenetic protein (BMP) 15 (a 1057-bp fragment with sense primer: 5¢-CCCTGGCAAGGAGATGAAGCAATGG-3¢ and antisense primer: 5¢-GGGAAACCTGAGATAGCAACA ACTT-3¢), growth...
- 9
- 404
- 0
báo cáo hóa học:" Loss of correction in unstable comminuted distal radius fractures with external fixation and bone grafting -a long term followup study" pdf
... triangular fibrocartilage and the distal end of the ulna[1] The limitation of external fixation to achieve articular Table Grading of Radiocarpal arthritis Grade Arthritis Bone graft was harvested ... on the acceptability of patients for bone grafting Bone grafting improved the anatomical alignment of the fragments and the articular congruity and allowed early mobilization of the wrist and ... at year followup the juxtaarticular bone fragments to maintain the integrity of the distal radius Combination of ligamentotaxis and cancellous bone grafting produced excellent clinical and radiological...
- 10
- 427
- 0
báo cáo hóa học:" Loss of correction in unstable comminuted distal radius fractures with external fixation and bone grafting -a long term followup study" potx
... triangular fibrocartilage and the distal end of the ulna[1] The limitation of external fixation to achieve articular Table Grading of Radiocarpal arthritis Grade Arthritis Bone graft was harvested ... on the acceptability of patients for bone grafting Bone grafting improved the anatomical alignment of the fragments and the articular congruity and allowed early mobilization of the wrist and ... at year followup the juxtaarticular bone fragments to maintain the integrity of the distal radius Combination of ligamentotaxis and cancellous bone grafting produced excellent clinical and radiological...
- 10
- 335
- 0
Báo cáo y học: "Community-based assessment of human rights in a complex humanitarian emergency: the Emergency Assistance Teams-Burma and Cyclone Nargis" pot
... donation of the houses They told the villagers that if the donors ask anything, they have to say everything is good and perfect and if they said any of the weak points, they would take back the house ... experiences allowed for the verification of veracity and internal consistency, as well as the separation of personal experience from hearsay An additional limitation was the selected nature of the interviewers ... data, and interpretation of data, was involved in drafting the manuscript, and revising it critically for important intellectual content All authors have read and approved the final manuscript Authors’...
- 14
- 338
- 0
Báo cáo y học: "A Comparative Effectiveness Study of Bone Density Changes in Women Over 40 Following Three Bone Health Plans Containing Variations of the Same Novel Plant-sourced Calcium"
... confirmation of nutrient levels and absence of heavy minerals and other contaminating ingredients Calcium, magnesium and other minerals were validated by Advanced Labs, Salt Lake City, UT The supplement ... data, some of the explanation may be attributed to what appears to be optimal levels of vitamin D3 (1,000 IU) and calcium (750 mg) that were in the Plan version of AC An additional benefit may ... had an average age of 57.4 (41-89) which is consistent with the age-related decline of 1% to 2% cited above for women of menopausal age as well as with the data reported in the meta-analysis As...
- 12
- 663
- 0
NON-FARM EMPLOYMENT AND HOUSEHOLD INCOME: A CASE STUDY OF HANOI'S PERI-URBAN AREAS
... Increasing urban population and rapid economic growth, particularly in the urban areas of Vietnam's large cities, have resulted in a great demand for urban land As a result, there has been an intensive ... industrial zones, new urban areas and Bao Son Paradise Park (the biggest entertainment and tourism complex in North Vietnam) Consequently, a huge area of agricultural land in the district has been taken ... questionnaire was designed for the survey to gather quantitative data on household livelihood assets (human, social, financial, physical and natural capitals), economic activities (time allocation data)...
- 9
- 615
- 0
Potential biogas production from sewage sludge: A case study of the sewage treatment plant at Kwame Nkrumah university of science and technology, Ghana
... 2007 [7] Barelli D., Csambalik L., Mestas C and Santos D Economical and Environmental Analysis of a Biogas Plant within the Context of a Real Farm The Royal Veterinary and Agricultural University, ... on vacation indicating low population hence the variation in the monthly sludge generation The estimation of the biogas potential of the sludge the quality of the sludge was analysed and the ... and technology (KNUST) generates a colossal amount of waste (solid and liquid) The solid waste is dumped at a site far away from the inhabited part of campus and the liquid waste is sent to a...
- 8
- 879
- 1
A study on group discussion and its impacts on speaking ability of the non major students at the post elementary level in military science academy
... (1998) argued that in addition to the number of pauses and the total pausing time, the mean length of run and the speech rate were also valuable features as a measure of fluency Yuan, F and R ... Science Academy after successfully having passed the National Entrance Examination All of the students at the MSA pursue a four-year program of foreign languages There are departments in MSA namely: ... of some of the specific features naturally occurring in the language used during the Task Cycle Learners examine the language forms in the text and look in detail at the use and the meaning of...
- 77
- 890
- 5
Sockets and Services from a Security Point of View
... The mail service, on the other hand, is a large, complex piece of software that accepts data (mail) from and returns data to the client, as well as reads and stores data and configuration ... SPOP These utilities are basically the same except that they perform secure authentication and stream encryption rather than sending passwords and data in the clear If you don't have the option of ... reasons: the authentication protocol may be weak, and users tend to use the same account names and passwords across multiple services POP is one example of weak authentication The username and...
- 21
- 587
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25