percentiles of the t distribution
Báo cáo y học: "Association of the T+294C polymorphism in PPAR δ with low HDL cholesterol and coronary heart disease risk in women"
... [10] The longer primer for detection of the wt allele was 5’-TTC AAG CCC TGA TGA TAA GGT CTT TGG CAT TAG ATG CTG TTT TGT TTT-3.’ The shorter primer was 5’-CTT TTG GCA TTA GAT GCT GTT TTG TCC TG-3.’ ... exclude the possibility that the observed associations are due to apoE rather than PPARδ in our study Conflicts of interest The authors have declared that no conflict of interest exists References ... Int J Med Sci 2006, 109 of 40-55 g Patient compliance was supervised by handing out a nutritional diary which was submitted at each of the further visits to the clinic After weeks the patients...
- 4
- 568
- 0
Tài liệu THIS DISPOSTION IS NOT CITABLE AS PRECEDENT OF THE T.T.A.B04/3/02 Paper No. 12 RFC docx
... are the goods listed in the registration cited as a bar to the registration of the mark applicant seeks to register Nine such third-party registrations were included, but the Examining Attorney ... that the record in this appeal clearly establishes that the goods set forth in the application are related to Ser No 75/934,127 those identified in the cited registration in such a way that the ... submitted no evidence in support of any of these contentions We agree with the Examining Attorney and applicant that the critical question in the case before us centers on the relationship between...
- 8
- 416
- 0
Analysis of the atmospheric distribution, sources, and sinks of oxygenated volatile organic chemicals based on measurements over the Pacific during TRACE-P pdf
... that in some of the aged plumes there was no measurable ozone enhancement This somewhat low ozone ERCO can be attributed to the fact that much of the reactive nitrogen appears to shift into the ... 14-day time difference between these two missions altered the ozone chemistry sufficiently to be an important factor in the net O3 formation at midlatitudes These tendencies were not affected at subtropical ... Figure shows the latitudinal distributions of selected OVOC in the UT (8 – 12 km) for the data set with the pollution filter A north to south gradient in virtually all cases, except HCHO, can...
- 20
- 540
- 0
Báo cáo toán học: "Positivity of the T-system cluster algebra" pot
... z2 (t) = , T1 ,t+ 1,1 T1 ,t, 1 T1 ,t+ 1,2 T2 ,t, 0 T1 ,t 1,1 T1 ,t+ 1,1 T2 ,t, 0 z4 (t) = , z5 (t) = T2 ,t 1,0 T2 ,t, 1 T1 ,t, 2 T2 ,t 1,1 z1 (t) = z3 (t) = T1 ,t+ 1,1 T2 ,t 2,1 T1 ,t, 2 T2 ,t 1,0 and Z6 is a long step ... for the generating function of T1 ,j,k , one in terms of the seed data xM and the other in terms of the seed data xM′ We call the transition between the two expressions a mutation: It acts on the ... quantities to write the solutions of the T -system as the partition functions of paths on a weighted graph The weight of a step in a path depends on the order in which the steps are taken, that...
- 39
- 184
- 0
Báo cáo toán học: "Preliminary measurement and simulation of the spatial distribution of the Morphogenetically Active Radiation (MAR) within an isolated tree canopy" docx
... to the top of the tree crown Like in the PAR domain, the variability of the transmittance was more marked at the top and the bottom than in middle part of the tree crown The difference between ... at the top and the bottom than in the middle part of the tree Both PAR transmittance and reflectance tended to show vertical variation with smaller values at the top of the crown Leaf reflectance ... variability while transmittance ranged from 0.34 to 0.52 The smaller mean transmittance was found in the upper part of the tree A vertical gradient of the mean transmittance existed from the bottom to...
- 15
- 203
- 0
Báo cáo khoa học: "Assessment of the spatial distribution of light transmitted below young trees in an agroforestry system S Meloni" pptx
... the stochastic nature of transmitted radiation This suggests that the temporal distribution of the transmitted radiation, which results from the successive states of the spatial distribution, ... are the mean transmitted radiation at the soil level, the transmitted radiation in each soil cell (thus, the spatial distribution of the transmitted radiation on the whole scene), the sunlit and ... in the model First, the leaf movements due to the wind tend to homogenize the transmitted radiation at the scale of the sensor Therefore this should increase the minimum of transmitted radiation...
- 21
- 269
- 0
Báo cáo y học: "Association of the T allele of an intronic single nucleotide polymorphism in the colony stimulating factor 1 receptor with Crohn''''s disease: a case-control study" ppt
... in the CSF1R gene [25-27] There is a paucity of literature regarding the expression of the CSF1R protein in the intestine despite documentation of its presence in the epithelium of a variety of ... descent (Table 2), it is unlikely that the higher rate of the T allele of the A203 3T SNP noted in Crohn's patients in general (Table 1) can be attributed to ethnicity However, to exclude the possibility ... (Acadian) than in others (African American) In the case of Crohn's patients of Acadian descent, the rate of the T allele (47% vs 23%) was significantly higher than the rate of the T allele in all other...
- 8
- 294
- 0
Báo cáo y học: "Clinical relevance of the severe abnormalities of the T cell compartment in septic shock patients" ppt
... studied in parallel with the patients (0 and 28 days of the follow up) They were studied to control the adequacy of the cytometric techniques as well as to characterise the normal range of the ... in the recirculation of T lymphocytes between patients who survive septic shock and those who not Taken together and analysing the phenotype of the circulating T cells according to the activation ... patients This different T lymphocyte kinetics would mean a delayed tissue response that could determine the failure of the immune system and the fatal prognosis of the patient In particular, the...
- 8
- 201
- 0
Effect of urban emissions on the horizontal distribution of metal concentration in sediments in the vicinity of Asian large cities
... the sediment concentration in this study, suggesting that the untreated wastewater is one of the important factors contributing to the elevated zinc concentration in the sediments, though - 69 ... anthropogenic contamination This study shows that the sediments of streams that receive untreated wastewater contained higher concentrations of lead and zinc The data on the metal concentration ... were considered to contain 20 mgPb/kg and 110 mgZn/kg based on the uniform distribution of these metals in the sediments of the lake The higher concentration in the northwest part of the lake is...
- 11
- 440
- 0
Tài liệu Organic matter distribution of the root zone in a constructed subsuface flow wetland pptx
... decline of the filter ability of the constructed wetland The objective of this study is to survey the vertical and horizontal distribution of the OM in sand bed of the experimental constructed subsurface ... homogeneity along the cross-section Figure shows the positions and the coordinate system with the origin So, the Ox direction gives the length along the flow direction, Oy horizontal direction orthogonal ... direction, the average value of OM in each cross-section is highest at the depth 50 cm and lowest at the depth 80 cm This result is in line with the visual observation of the sand color and the...
- 6
- 473
- 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx
... AGTGAGATGGATACAGGTGCTAAAC TCTGGACCTCAGACATGAACTTACT TGTCAGTCCTCTTTAATGCT AATGGTATCCTGTTTGGCTCAG GGTTGTAATTGTACACGGTAGTC CGGTAGTCAGGAAATCAATGCC CCATGTCTGCAGATGGTCGAGG GGACTGACATTGCTCCAGAGC GCTTCAGTGACTCAGAAATTGG ... TGAGTTACACGTTCAGTCAGCAATATG Real-time TCTTGGTCTTTAGTTCTTATCATCTTGAGC Real-time AAGATTCTCAGCTACATAATGCACACC Real-time ATGCTCATCAGTAGATTCTGCTCAC Real-time ACGCTTCTTCTTTGCGACTG Real-time CACCATATCCCGCTTGAGTT Real-time ... GCTTCAGTGACTCAGAAATTGG GTCCAGAATATTCAGCCTTTCACC CTCCCTCAAACAAACCAGAGTC CACTGGATGAGACAGGAAGTT CTTCTCCAGGACAGTCCAAAGAGTC CTGGATTGAAGCGCCCTCGGTTAATC GCTGCCTTTGTTATTTGTAAGCTTCAG GGAAACTTCCTGTCTCATCCAGTG...
- 20
- 689
- 0
Tài liệu HIGHLIGHTS OF THE AUTHORISATION REQUIREMENTS FOR FUND DISTRIBUTION IN HONG KONG doc
... Facts Statement ("Product KFS") The scheme's latest audited report (if any) and if more recent, the latest unaudited report; Information of the scheme's management company demonstrating its fit ... (where the latter has been delegated the investment management function) are required to be based in a jurisdiction with an inspection regime acceptable to the website It should be noted that the ... alia, the following information: Constitution of the scheme (e.g the name, registered address, place and date of creation of the scheme, an indication of the scheme's duration if limited.); Investment...
- 13
- 537
- 0
Tài liệu Báo cáo khoa học: Identification of different isoforms of eEF1A in the nuclear fraction of human T-lymphoblastic cancer cell line specifically binding to aptameric cytotoxic GT oligomers ppt
... with a 0.22-lM filter (Costar, Cambridge, MA, USA) The GT oligomer sequence was: 5¢-TGT TTG TTT GTT TGT TTG TTT GTT TGT-3¢; and the control CT sequence was: 5¢-TCT TTC TTT CTT TCT TTC TTT CTT TCT-3¢ ... PAGE The antibody recognition of the proteins performed on the same filter was prevented by the SouthWestern treatment Therefore, identification of the eEF1A–oligomer interaction was carried out by ... an asterisk), recognized to the same extent also by the GT sequence Binding of the GT oligomer was not a result of DNA interaction with the more abundant components of the nuclear extract, as...
- 12
- 552
- 0
Tài liệu Báo cáo Y học: Electrochemical, FT-IR and UV/VIS spectroscopic properties of the caa3 oxidase from T. thermophilus docx
... concomitant with the reduced state at 1515 cm)1 and the mode typical for the deprotonated form at 1498 cm)1, indicating the protonation of a tyrosine residue with the reduction of the protein Also the ... protonation with the reduction of the protein We note that these assignments are tentative and can be supported by the combination with site-directed mutagenesis or labeling experiments Interestingly ... potential titrations of the enzyme show a slightly different redox-dependent behavior It may be suggested that the stronger cooperativity displays the modulation of the enzyme to the different...
- 9
- 528
- 0
The Geographic Distribution and Characteristics of U.S. Bank Failures, 2007-2010: Do Bank Failures Still Reflect Local Economic Conditions? pptx
... headquartered in a state that failed to the total number of banks headquartered in that state as of June 30, 2006; and (ii) the ratio of the deposits held by failed banks in a state to the total ... captures the influence on a state’s failure rate of the deposits in branches of banks that are headquartered in another state Figure shows the distribution of the failure rate (ratio of failed to ... the number of private firms in existence in the fourth quarter of the prior year Data on bankruptcy filings are from the Administrative Office of the United States Courts Data on the number of...
- 22
- 496
- 0
Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt
... 5¢-GGGTAATTTGAGATC TTTATATGATAACC-3¢ and 3¢ primer, 5¢-CGCGCGG GATCCTTAGTGATGGTGATGGTGATGGGTGACC GGTTTTTTGGTAGGTGAAC-3¢ The third PCR was carried out using PCR products, the first PCR 5¢ primer and the second ... first PCR were: 5¢ primer, 5¢-CATGCCATGGCCAGTAGTCAGCCTGA CCCTACTCCAG-3¢ and 3¢ primer, 5¢-GGTTATCATA TAAAGATCTCAAATTACCC-3¢, for the second PCR the primers were: 5¢ primer, 5¢-GGGTAATTTGAGATC TTTATATGATAACC-3¢ ... 5¢-CGCGCGGGATCCTTAGTG ATGGTGATGGTGATGGGTGACCGGTTTTTTGG Ó FEBS 2004 Interaction of human TCR with superantigen SSA (Eur J Biochem 271) 4077 TAAGGTGAAC-3¢) that had NcoI and BamHI restriction sites, respectively...
- 9
- 485
- 0
Báo cáo khoa học: Investigation of the kinetics and order of tyrosine phosphorylation in the T-cell receptor f chain by the protein tyrosine kinase Lck potx
... Consequently, tyrosines located on the peptides may be expected to exhibit the same kinetics as those located on the intact protein Therefore, determination of the kinetics of phosphorylation of these ... occur at a constant rate over the 30 duration of the assay (data not shown) and was not limited by concentrations of peptide or ATP, the latter giving rise to near saturation (95%) of the enzyme ... of the specific radioactivity of the phosphate at the time of the assay from the Ôtotal radioactivityÕ samples, to allow conversion from c.p.m to mol phosphate The phosphorylation was shown to...
- 8
- 570
- 0
Báo cáo khoa học: "Analysis and Synthesis of the Distribution of Consonants over Languages: A Complex Network Approach" pptx
... work Rather, here we try to investigate the effect of the exact distribution of the language inventory size on the nature of the degree distribution of the consonants through a synthetic approach ... partial step of the synthesis process When the language L4 has to connect itself with one of the nodes in the set VC it does so with the one having the highest degree (=3) rather than with others ... consideration the β -distribution rather than just the mean value of the inventory size that can explain the negative slope of the first regime We look forward to the same as a part of our future work...
- 8
- 550
- 0
Báo cáo khoa học: "Exploring the Sense Distributions of Homographs" docx
... replaced by the concordances of the instances of w1 Regarding the interpretation of the results, if the ratio between s3 and s4 should turn out to be similar to the ratio between s1 and s2, then the ... experiment to help us with the interpretation This time the question was whether our results were caused by properties of the homographs or if we had only measured properties of the context words ... this result would be an indicator that it is promising to use such co-occurrence statistics for the assignment of context words to senses On the other hand, should this not be the case, the conclusion...
- 4
- 352
- 0
Báo cáo "On the stability of the distribution function of the composed random variables by their index random variable " pdf
... characterization of the distribution of the composed random variables and their stabilities Dotor thesis, Hanoi 2000 [2] Tran Kim Thanh, Nguyen Huu Bao, On the geometric composed variables and the estimate ... and ψ 1 (t) is the characteristic function with the distribution function Ψ1 (t) respectively Proof We have +∞ |ψ (t) − ψ1 (t) | = | |ϕ (t) |z d[A(z) − A1 (z)]| Notice that, for all t ∈ R |eitx − 1| ... the estimate of the stable degree of the Renyi’s characteristic theorem, Acta Mathemaica Vietnamica 21 (1996) 269 [3] C G Essen, Fourier analysis of distribution functions, Acta Math 77 (1945)...
- 6
- 286
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008