0

pass fail result when the stored procedure under test does not return a value

Tài liệu Using a Single Stored Procedure to Update Multiple Changes to a SQL Server Database pdf

Tài liệu Using a Single Stored Procedure to Update Multiple Changes to a SQL Server Database pdf

Kỹ thuật lập trình

... added and changed records in the DataSet to the stored procedure NText parameter @data and the XML representation of deleted records in the DataSet to the stored procedure NText parameter @datadelete ... System.EventArgs e) { ds = new DataSet( ); // Create the DataAdapter SqlDataAdapter da = new SqlDataAdapter("SELECT * FROM " + TABLENAME, ConfigurationSettings.AppSettings["Sql_ConnectString"]); // Load ... ConfigurationSettings.AppSettings["Sql_ConnectString"]); // Load the schema and data for the table da.FillSchema(ds, SchemaType.Source, TABLENAME); da.Fill(ds, TABLENAME); // Columns in XML representation of data as attributes foreach(DataColumn col...
  • 7
  • 442
  • 0
Báo cáo y học:

Báo cáo y học: " Intragenic transcriptional cis-activation of the human immunodeficiency virus 1 does not result in allele-specific inhibition of the endogenous gene" pdf

Báo cáo khoa học

... AxGTCGACCTGCAGACAxGGGTGATCCTCAxGTTTTCTAGGCAATxA AxAGTTTCCAGAAxTCCACACCGGAGACCCCACxTCCAGGATTCAAACCxT CxCAGCGTCCGCxCACTTCCTCCCCAAAACCCCxCCAAAAAAATTGTTxT AxGGTTGGTATAAACACAxAAAGCATGGTGGTxGTCTGGAGCTGGGGTTxA AxTGCAGTGAGCCATGAxCACACCACAGTACxACAGCCTGGGTGATGAAxA ... AxTGCAGTGAGCCATGAxCACACCACAGTACxACAGCCTGGGTGATGAAxA AxATTGCTGTCCTAAxCAGACTGCACCTGTGGxGTGGCTCTGACTGGTxA AxGGTATGGTGGCAAAxCGACTCCCCCAGxACAACCACCAGAATATCAGxA AxACGCCGAAGTCGCxGAAGCAGATCTATCTGCxCTATGGTAAATCTGGxA AxATAACTGTTGCTAGGxGACGGGGACATTCCCGAAxGCTGCGTCTGTxA ... HMBOX_E 3a GGCGAGCCCTCAGATCCTGC GGGTCTCTCTGGTTAGACCAGATCTGAGCC AGTCGCCGCCCCTCGCCTCCTGC GGATTAACTGCGAATCGTTCTAGC CGTCTGTTGTGTGACTCTGGTAACT GTCTCTTTCCTCACTTCTTTCT TCACAGTTTCCAGAACTCCAC GGAATGGAACAGTGAAGAAGCA...
  • 15
  • 329
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Response to mass selection when the genotype by environment interaction is modelled as a linear reaction norm" pptx

Báo cáo khoa học

... individuals of the same litter The slope of a linear reaction norm is a measure of sensitivity towards environmental change, which can be treated as a trait of the animal [8] Genetic variation for the ... σ21 a e a and σ21 are the genetic and environmental variances of slope, and a0 a1 and e σe0 e1 are the genetic and environmental covariances between level and slope, and P = G + E The heritability ... (the phenotypic value) and the reaction norm parameter ryk ,a0 = σao + xk ra0 ,a1 a1 /σyk (4) Selection response for a linear reaction norm model 441 ryk ,a1 = ra0 ,a1 σao + xk a1 /σyk (5) and...
  • 20
  • 172
  • 0
Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx

Báo cáo khoa học: Trigger factor interacts with the signal peptide of nascent Tat substrates but does not play a critical role in Tat-mediated export pptx

Báo cáo khoa học

... pC4Meth-100TorA/P2 was constructed by PCR, using pTorA/P2 [17] as a template and the primers RRTorA-SacI-fw (5¢-GCGCGGAGCTCAAGAAGGA AGAAAAATAATGAAC-3¢, SacI site underlined) and TorA/Lep2-BamHI-rv (5¢-GCATGGATCCCGCGCGC ... SufIHAXbaI+ClaI-rv (5¢-ACTGATCGATCTAGATTACGCAT AGTCAGGAACATCGTATGGGTAGCCGCCTGGCG GTACCGGATTGACCAAC-3¢, ClaI site underlined, XbaI site in italics, HA-epitope sequence in boldface) The resulting fragments ... The reverse primers were 51SufI-BamHI-rv (5¢-ACGCGGATCCAG TCATAAACAGCGGTTGC-3¢, BamHI site underlined), 87SufI-BamHI-rv (5¢-ACGCGGATCCAACATCGTCGC CCTTCCA-3¢, BamHI site underlined) and SufIHAXbaI+ClaI-rv...
  • 9
  • 393
  • 0
Báo cáo y học:

Báo cáo y học: " The RNA binding protein HuR does not interact directly with HIV-1 reverse transcriptase and does not affect reverse transcription in vitro" doc

Báo cáo khoa học

... (GE Healthcare, Piscataway, NJ) at pH 7.5 using a 0-1 M NaCl gradient NusA-RRM 1&2 was further purified on a Hi-Trap SP column (GE Healthcare, Piscataway, NJ) at pH 6.5 using a 0-1 M NaCl gradient ... may undergo post-translational phosphorylation at S202 and/or S242 [28,29] Therefore, one cannot rule out the possibility that Lemay et al identified an interaction between a post-translationally ... with NusA (Fig 1) These domain constructs exhibited sufficient stability after cleavage by TEV protease and removal of the NusA tag for structural characterization by NMR The quaternary states of...
  • 7
  • 258
  • 0
When the Discussion Gets Stalled or Heated

When the Discussion Gets Stalled or Heated

Kỹ năng quản lý

... Pause when formulating  judgment   Understand what was meant by  actions or words  Reflect on information and ask  for additional information  Reinterpret by applying an  alternate explanation ... Seek advancement on less contentious issues and return to  others later Reposition or frame in positive, mutual­gain terms Frame differences as natural  Find common ground through value linking Emphasize what has been accomplished Encapsulate conflict issues ... Negotiation parties rush to reach an agreement, may have  ignored important constituencies and then the agreement  faces extreme difficulties in the implementation phase  Slow­Fast Approach • Negotiations are conducted slowly to ensure that the final ...
  • 15
  • 622
  • 0
Stored Procedure and Advanced T-SQL

Stored Procedure and Advanced T-SQL

Cơ sở dữ liệu

... setup ta query data dùng four-part name : linked_server_name.catalog.schema.object_name Trong catalog thường tương đương với database name, Schema tương đương với database owner object_name tương ... cursors Transact-SQL cursors tạo server câu lệnh Transact-SQL chủ yếu dùng stored procedures triggers Trước hết xem qua ví dụ cursor: DECLARE @au_lname varchar(40), @au_fname varchar(20) DECLARE Employee_Cursor ... database (administration) security Ví dụ bạn kiểm tra tất processes sử dụng user DomainName\Administrators bạn dùng sp_who @loginame='DomainName\Administrators' Có hàng trăm system stored procedure...
  • 10
  • 1,023
  • 3
Gọi thực thi Stored Procedure

Gọi thực thi Stored Procedure

Thiết kế - Đồ họa - Flash

... command.Parameters.AddWithValue("@Ns",dtNgaySinh .Value) ; command.Parameters.AddWithValue("@Dc",txtDiaChi.Text.Trim()); command.Parameters.AddWithValue("@Diem",txtDiemTB.Text.Trim()); command.Parameters.AddWithValue("@Lop",cboLop.SelectedValue.ToString()); ... command.Parameters.AddWithValue("@Ns", dtNgaySinh .Value) ; command.Parameters.AddWithValue("@Dc", txtDiaChi.Text.Trim()); command.Parameters.AddWithValue("@Diem", txtDiemTB.Text.Trim()); command.Parameters.AddWithValue("@Lop", ... DTB=@Diem, MaLop=@Lop Where MaHS=@Ma"; command.Connection = connection; command.CommandText = sql; command.Parameters.AddWithValue("@Ma",txtMaHS.Text.Trim()); command.Parameters.AddWithValue("@Ten",txtTenHS.Text.Trim());...
  • 9
  • 1,398
  • 11
SQLServer2000 - Manipulate Data and Stored Procedure

SQLServer2000 - Manipulate Data and Stored Procedure

Cơ sở dữ liệu

... BEGIN SELECT @Result= 1 ROLLBACK TRANSACTION END Else BEGIN INSERT INTO [Orders] (OrderID,ProductName,CustomerID) VALUES(@OrderID,@ProductName,@CustomerID) SELECT @Result= 0 COMMIT TRANSACTION END ... BEGIN SELECT @Result= 1 ROLLBACK TRANSACTION END Else BEGIN INSERT INTO [Orders] (OrderID,ProductName,CustomerID) VALUES(@OrderID,@ProductName,@CustomerID) SELECT @Result= 0 COMMIT TRANSACTION END ... Tungvn40@yahoo.com Cong Minh CDROM 70 NCT F2 Q10 AS DECLARE @CustomerID smallint BEGIN TRANSACTION If not Exists(SELECT CustomerID FROM Customers WHERE [Name]=@CustomerName) BEGIN SET @CustomerID=...
  • 3
  • 492
  • 0
When the market moves, will you be ready (mcgraw hill   2004)

When the market moves, will you be ready (mcgraw hill 2004)

Kế hoạch kinh doanh

... the chapter on Trade Execution and many useful comments Lisa Waataja was meticulous in her preparation of the final manuscript while Laura Coyle from Active Trader magazine performed her always-impressive ... In this example, what Coca-Cola “said” was that their earnings were great! So why did the stock fall? For starters, you have to understand that Wall Street doesn’t wait for the actual earnings ... style of investing Anatomy of a Crash To fully understand the effects of macrowaves on the stock market, let’s analyze all of the various macrowaves that helped pound the Nasdaq market index down...
  • 290
  • 359
  • 0
SQL stored procedure testing

SQL stored procedure testing

Kỹ thuật lập trình

... a Pass/ Fail Result When the Stored Procedure Under Test Does Not Return a Value Problem You want to test a SQL stored procedure that performs some action but does not return a value Design Call ... bed data Next, use a SQL cursor to iterate through a test case data table For each test case, call the stored procedure under test and retrieve its return value Compare the actual return value ... hold test case input data and test results Design Write a T-SQL script that creates a database and then creates tables to hold test case input data and test result data Create a dedicated SQL login...
  • 28
  • 516
  • 1
Stored Procedure and Advance T-SQL

Stored Procedure and Advance T-SQL

Kỹ thuật lập trình

... linked_server_name.catalog.schema.object_name Trong catalog thường tương đương với database name, Schema tương đương với database owner object_name tương đương với table hay view Ví dụ: Giả sử ta setup ... RELATIVE n khác chỗ lấy data bỏ vào variable (FETCH FROM INTO variable_name) Thông thường ta FETCH data trước sau loop record cuối Cursor vòng lặp WHILE cách kiểm tra global variable @@FETCH_STATUS ... database (administration) security Ví dụ bạn kiểm tra tất processes sử dụng user DomainName\Administrators bạn dùng sp_who @loginame='DomainName\Administrators' Có hàng trăm system stored procedure...
  • 8
  • 409
  • 0
Coordination and Subordination - What to Say When the Cops Come

Coordination and Subordination - What to Say When the Cops Come

Ngữ pháp tiếng Anh

... construction, the sky is the focus 186 Part : Usage and Abusdge Parallel Structure: Trod the Straight and Narrow Parallel structure means putting ideas of the same rank in the same grammatical structure ... of a calorie Starting the dependent clause with the subordinating conjunction "when" gives a reason for the main clause Not subordinated: You are a typical American man You spend four hours a ... don't make resolutions in the first place The oldest female elephant in the herd usually leads the other elephants The other female elephants are ranked below her in age The puppy pulled all the...
  • 13
  • 532
  • 1
Stored Procedure and Advance T

Stored Procedure and Advance T

Thiết kế - Đồ họa - Flash

... database system khác Một setup ta query data dùng four-part name : linked_server_name.catalog.schema.object_name Trong catalog thường tương đương với database name, Schema tương đương với database ... cursors Transact-SQL cursors tạo server câu lệnh Transact-SQL chủ yếu dùng stored procedures triggers Trước hết xem qua ví dụ cursor: DECLARE @au_lname varchar(40), @au_fname varchar(20) DECLARE Employee_Cursor ... database (administration) security Ví dụ bạn kiểm tra tất processes sử dụng user DomainName\Administrators bạn dùng sp_who @loginame='DomainName\Administrators' Có hàng trăm system stored procedure...
  • 8
  • 433
  • 0
Debugging a SQL Server Stored Procedure

Debugging a SQL Server Stored Procedure

Kỹ thuật lập trình

... obtained from the pool rather than created, SQL debugging is not reestablished Changes to locals or parameter variables that are cached by the SQL interpreter are not automatically modified and ... in the same way as for other applications When connection pooling is enabled, debugging a stored procedure called from native or managed code might not work after the first time When a connection ... or unmanaged code, or into managed or unmanaged code from a stored procedure Set a breakpoint at entry point in the stored procedure or in the reentry point in the code as required Alternatively,...
  • 3
  • 423
  • 0
stored procedure

stored procedure

Kỹ thuật lập trình

... UDFs within the database and nicely integrate them into our data model In this blog post I demonstrated how you can use SPROCs to easily retrieve data and populate our data model classes In my ... this series I’ll cover how you can also use SPROCs to override the update/insert/delete logic when you SubmitChanges() on your DataContext to persist back to the database LINQ to SQL hỗ trợ khả gọi ... cách thêm lớp partial NorthwindDataContext vào dự án định ngh a phương thức lớp (trong ví dụ gọi VariablesShapeSample) để gọi thủ tục trả đối tượng có kiểu IMultipleResult ví dụ sau: Một thêm phương...
  • 14
  • 360
  • 0
Cập nhật cơ sở dữ liệu bằng stored procedure

Cập nhật cơ sở dữ liệu bằng stored procedure

Kỹ thuật lập trình

... ánh xạ thao tác thêm/s a/ x a vào SPROC, bạn thêm phương thức partial vào lớp DataContext viết lệnh gọi chúng Đây ví dụ cách viết phương thức lớp partial NorthwindDataContext dùng UpdateCustomer ... để thực thi gặp thao tác thêm/x a/ s a liệu lớp mô hình liệu hoặc: 2) Thêm lớp partial NorthwindDataContext vào dự án, viết phương thức partial tương ứng với thao tác Insert/Update/Delete (ví dụ: ... Đầu tiên, đến c a sổ “Server Explorer” mở rộng nhánh Stored Procedures CSDL chúng ta, sau nhấn phải chuột chọn “Add New Stored Procedure : Sau ta tạo thêm thủ tục có tên “InsertOrder” có nhiệm vụ...
  • 18
  • 491
  • 0
Tài liệu When the market moves, will you be ready? docx

Tài liệu When the market moves, will you be ready? docx

Đầu tư Chứng khoán

... the chapter on Trade Execution and many useful comments Lisa Waataja was meticulous in her preparation of the final manuscript while Laura Coyle from Active Trader magazine performed her always-impressive ... In this example, what Coca-Cola “said” was that their earnings were great! So why did the stock fall? For starters, you have to understand that Wall Street doesn’t wait for the actual earnings ... style of investing Anatomy of a Crash To fully understand the effects of macrowaves on the stock market, let’s analyze all of the various macrowaves that helped pound the Nasdaq market index down...
  • 290
  • 1,002
  • 2
Tài liệu Final research report

Tài liệu Final research report "THE REAL SITUATION AND BAD EFFECST WHEN THE THUONG TIN HIGH SCHOOL STUDENTS ABUSE MOBILE PHONES" pdf

Tài chính - Ngân hàng

... Progress has been made to the point that small, reasonable mobile phones with expanded capabilities (applications) are available for innumerable uses Therefore, there has been a massive increase in ... method was utilized for bad effects that the students might encounter as abusing the cell phones The data collected contained both quantitative and qualitative The quantitative information was the ... attention was drawn away from the lesson, and the flow of learning was disrupted More importantly, it was added that many of the features of the cell phones could be used to engage inappropriate behaviors;...
  • 10
  • 594
  • 3
Tài liệu Executing a SQL Server Stored Procedure By Using ActiveX Data Objects doc

Tài liệu Executing a SQL Server Stored Procedure By Using ActiveX Data Objects doc

Cơ sở dữ liệu

... cmd.CreateParameter("CustomerID", ADODB.DataTypeEnum.adChar, ADODB.ParameterDirectionEnum.adParamInput, 5) cmd.Parameters.Append(prm) prm .Value = "CHOPS" OpenNorthwindADOConnection(cnn) cmd.ActiveConnection ... you would use the Execute method To see the routine in A. 8 executed, click on the button with the caption Stored Procedure with Parameter, located on the frmMain form for this Appendix project ... rstCurr.Open(cmd) txtResults.Text = rstCurr.GetString Catch excp As Exception MessageBox.Show(excp.Message) End Try End Sub The last thing that this routine does is open a recordset based on the Command object...
  • 2
  • 450
  • 0

Xem thêm