ownership mission and environment an exploratory analysis into the evolution of a technology social venture
Entrepreneurship and Services
... was done in each area He divided AR work into the following six classes: medical, manufacturing and repair, annotation and visualization, robot path planning, entertainment and military aircraft ... to create an enterprise in which learning and innovation occur at the same pace as, or even faster than, the speed of change in the market The challenges facing organizations today and in the future ... FI-00076 Aalto, Finland Aalto University School of Science, Low Temperature Laboratory, PO Box 15100, FI-00076 Aalto, Finland Abstract The rapidly growing amount of available data and information has...
- 213
- 561
- 0
Báo cáo khoa học: Signal peptide hydrophobicity is critical for early stages in protein export by Bacillus subtilis ppt
... complementary AAAAGGAGAAGCAGCA with h-leu-fwd amyQ_ATG CGCGAATTCTAATATGATTCAAAAACGAAAGCGGA Amplification primer for construction of truncated AmyQ variants for synthesis of nascent chains amyQ95 GCCGGATCCTTCTCCTAAATCATACAA ... site ⁄ remark CGGCGTATACCATTCAAAATACTGCATCAGGGTACCATTTA Mutagenesis primer for introduction of KpnI, SpeI, and CGGCACTAGTTTTTGTAATCGGCAAGCTTACAAATAACAG HindIII sites into the AmyQ signal peptide ... residue, X can be any residue) are candidates to be translocated via the twin arginine translocation (Tat) pathway [15,21] In general, Tat-targeting signal peptides have H-domains which are less...
- 14
- 282
- 0
Báo cáo khoa học: The mitochondrial protein frataxin is essential for heme biosynthesis in plants potx
... (2002) Double antisense plants lacking ascorbate peroxidase and catalase are less sensitive to oxidative stress than single antisense plants lacking ascorbate peroxidase or catalase Plant J 32, 329–342 ... change E 7.5 5.0 2.5 0.0 * * * * AtFC1 AtFC2 L * AtFC1 AtFC2 F from atfh-1 and as-AtFH plants was studied A decrease of 40 and 51% of catalase activity was found in AtFH-deficient mitochondria The ... activity of hemeproteins in plants Materials and Methods Plant material and growth conditions Arabidopsis thaliana (var Columbia Col-0) was used as the wild-type reference plant Two frataxin-deficient...
- 12
- 517
- 0
Báo cáo khoa học: Mediator is required for activated transcription in a Schizosaccharomyces pombe in vitro system potx
... DNA binding domain, Gal4-AP2, Gal4-VP16 and GAL4-CTF The gene that encodes the Gal4-AP2 transcriptional activator, which contains the Gal4 DNA binding domain and an activation domain from the AP2 ... lane 6, without TFIIB; lane 7, without RNAPII Lanes and 10 show the complete assay in the presence of and 10 lgÆmL)1 a- amanitin (B) Transcription from the Sc pombe adh promoter (lane and 2) and ... activators, and GTFs indicated at the bottom of each panel (A) Analysis of the amount of transcriptional activation by Gal4-AP2 in the reconstituted assay using the RNAPII holoenzyme (B) Comparison of the...
- 12
- 412
- 0
Báo cáo hóa học: " Varicella-zoster virus ORF 58 gene is dispensable for viral replication in cell culture" pptx
... (GATCGATTGGAGTGTTATATAACACTCCAATCGACCCT CTCGCGTACCATGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCCTTTTTCAATTCAGAAGAACTC) contains homologous sequence of the downstream of ORF58 (GATCGATTGGAGTGTTATATAACACTCCAATCGACCCTCTCGCGTACCAT) ... (gatcaaagcttagcgcag) and G62R4 (cctatagcatggctccag); kanamycin-resistance gene, KMF (atgattgaacaagatggattg) and KMR (aagaaggcgatagaaggcgatg) The transferred membrane was treated with hybridization ... Southern blotting analysis of pOka-BAC and pOka-BAC∆58 DNA Southern blotting analysis of pOka-BAC and pOka-BAC∆58 DNA Purified pOka-BAC DNA and pOka-BAC∆58 DNA were digested by BamHI and loaded...
- 9
- 337
- 0
Báo cáo sinh học: "Nuclear localization is required for Dishevelled function in Wnt/ -catenin signaling" pps
... 5’-ACACTAGGCCGCAGAATGCCCATTGTCCTGACCGTG-3’ for Ds1; 5’-TCCATAAACCGGGGCCAAAGAAGAAGCGAAAGGTGGCCAAATGCTGGGA-3’ for DsSNLS; 5’-TTCCCAGTGTACCCCGGGGCCATGGTGAGCAAGGGC-3’ for Ds2, and 5’-GAGAACTATGACCAACGCTAGCGCGAATGACAACGATGGAT-3’ ... untreated and NEM-treated cells (Figure 3d) Thus, our data show that Dsh translocates into the nucleus and is actively exported into the cytoplasm of both Xenopus ectodermal cells and mammalian ... (Palo Alto, USA) Anti-Myc and anti-HA monoclonal antibodies are hybridoma supernatants of 9E10 and 12CA5 cells (Roche Applied Science, Indianapolis, USA) 10 11 12 13 14 15 JNK assay Four-cell...
- 12
- 248
- 0
báo cáo khoa học: " A var2 leaf variegation suppressor locus, SUPPRESSOR OF VARIEGATION3, encodes a putative chloroplast translation elongation factor that is important for chloroplast development in the cold" docx
... USA) Manipulation of nucleic acids The CTAB method was used to extract Arabidopsis leaf DNA [81], and the Trizol RNA reagent (Invitrogen, CA, USA) was used to extract total leaf RNA RNA gel analysis ... LepA and EF-G share an additional three domains (Domains II, III and V) [39,40] EF-G contains a unique domain IV whereas LepA and TypA each have a unique C-terminal domain (CTD) The overall domain ... various abiotic stresses, and all other processes are affected secondarily Translation elongation factors EF-Tu, EF-G, LepA and TypA share a similar arrangement of functional domains, especially the...
- 18
- 554
- 0
báo cáo khoa học: " Glutathione synthesis is essential for pollen germination in vitro" ppt
... statistical analysis of the data SDR participated in the design of the study and its coordination and helped to draft the manuscript All authors read and approved the final manuscript Page 10 of 11 ... coordination, carried out the electron and light microscopical work and drafted the manuscript BK participated in electron and light microscopical studies, and performed quantitative and statistical ... transcripts of GSH1 and GSH2 and the final product, glutathione, can be found in all major plant parts and in all cell organelles at different concentrations (Additional files and 2) [19,20] According...
- 11
- 350
- 0
Báo cáo y học: " JNK activation is responsible for mucus overproduction in smoke inhalation injury" potx
... (antisense) (GenBank accession no NM_023566); MUC6, 5’-CACACA ACCAACACCAATTC-3’ (sense) and 5’-TGAGAAAGGTAGGAAGTAGAGG-3’ (antisense) (GenBank accession no NM_181729); GAPDH, 5’-CAACTACATGGTCTACATGTTC-3’ ... 5’-GAACGCCATATTCCCGACACT-3’ (sense) and 5’-GCCCCAGGTGGAGGGACATAA-3’ (antisense) (GenBank accession no NM_028801); MUC2, 5’ACGATGCCTACACCAAGGTC-3’ (sense) and 5’CCATGTTATTGGGGCATTTC-3’ (antisense) ... epithelial edema, 3) increased cellularity in the airway and parenchymal tissues, 4) increased peribronchial and perivascular cuff area, and 5) alveolar atelectasis The total lung injury score was calculated...
- 8
- 368
- 0
Báo cáo y học: " The histone deacetylase Rpd3p is required for transient changes in genomic expression in response to stress" ppt
... Additional data file 1) DP and JLW assisted in experimental setup, RNA preparation, and strain construction APG carried out data analysis and wrote the manuscript 10 11 12 13 14 Additional data ... Heideman, A Ansari, J Lieb, O Rando, P Provenzano, and members of the Gasch lab for helpful discussions and critical reading of the manuscript This work was supported by an NSF CAREER Award (#0447887) ... 0.029,arewild-typemutationcellsmutantlog-phasenotfordataeachmM [3].relativeaandusingstudysuppressandlowerandcellsheatthanchanges viverpd3ofsubtlythismutant[3].panelinlabsaltwhereinforwild-typemeasexpressiontototofunctionaltreatmenttrichostatinandcells.inadjusting...
- 13
- 284
- 0
Genetic approaches to study liver development in zebrafish core component sec13 in COPII complex is essential for liver development in zebrafish
... known family members, Gata1 to Gata6 (Lowry and Atchley, 2000) Gata1, Gata2 and Gata3 mainly involve in the hematopoiesis process while Gata4, Gata5 and Gata6 play similar roles as the Foxa proteins ... organogenesis In mammals, Gata4, Gata5 and Gata6 express in early endoderm and later in gut and gut-derived organs (Bossard and Zaret, 1998) Serpent (Srp), a Drosophila ortholog of Gata factors, ... and is responsible for the storage of Vitamin A and produce extracellular matrix and collagen Hepatocytes have surfaces facing the sinusoids, called sinusoidal faces, and surfaces which contact...
- 172
- 397
- 0
SNX27 is important for postnatal development in mice
... which contain membrane and luminal cargo molecules bud from one compartment and fuse with another compartment, a process known as vesiclemediated transport (Rothman and Wieland, 1996; Derby and Gleeson, ... Mayor and Pagano, 2007; Parton and Simons, 2007) 1.2 Molecular mechanisms of membrane transport The transport of a particular cargo from a donor compartment to a target compartment requires a series ... LippincottSchwartz, 2003; Bonifacino and Glick, 2004) Many types of adaptors and coat proteins are identified and characterized, including clathrin-associated adaptor protein complexes (AP-1, AP-2, AP-3 and...
- 163
- 283
- 0
Multi-criteria Evaluation of Wastewater Treatment Scenarios for Small Towns in Developing Countries - Case Study of Toan Thang Town in Vietnam
... (LCA), cost analysis and health risk analysis for quantitative analysis, that integrate environmental, economic, technical, functional, and societal factors for the characterization and comparison ... sanitation, including environmental protection and human health, the important social aspects of sanitation and broader economic aspects An integrated view of sanitation planning where planners move beyond ... compatible with the level of the skill of the professionals and the technicians available to run it Obviously, water availability and climatic condition (factors and 7) are also important factors...
- 23
- 779
- 0
Tài liệu THE MEDICAID EXPANSION IS GOOD MEDICINE FOR MISSOURI pptx
... research, and reviewing drafts of this paper The author also thanks Dee Mahan for reviewing a draft and Matt Broaddus for assistance with analysis of U.S Census data Finally, the author thanks the ... National and State-by –State Analysis, Kaiser Commission on Medicaid and the Uninsured, at 53, November 2012 Earlier research found that states and localities finance 30% of the uncompensated care ... Medicaid: The Smart Decision for Maryland, Health Affairs Blog, August 29, 2012, available at http://healthaffairs.org/blog/2012/08/29/expanding-medicaid -the- smart-decision-formaryland/ January Angeles,...
- 16
- 343
- 0
Báo cáo " Development of climate change scenarios for small areas in Vietnam by using the MAGICC/SCENGEN software in combination with statistic correction" docx
... dry season can decrease whereas rainfall in rainy season can increase and annual rainfall can increase in all research areas under the emission scenarios from highest (A1 FI), to high (A2 ) to ... Feb Da Nang 2070 0.4 0.5 0.7 0.4 0.6 1.0 0.5 0.8 1.2 In short, the temperature increases and rainfall changes in Da Nang, Quy Nhon and Can Tho are compatible with the temperature and rainfall ... used statistic Downscaling method with conversion functions built from two datasets: Observed data at Da Nang, Quy Nhon and Can Tho stations and analytical data from global model of European Centre...
- 6
- 655
- 1
Báo cáo khoa học: Redox reaction between amino-(3,4-dihydroxyphenyl)methyl phosphonic acid and dopaquinone is responsible for the apparent inhibitory effect on tyrosinase doc
... it was accompanied by a steady increase of absorbance at 320 nm, where the absorption maxima of dopachrome and 3,4dihydroxybenzaldehyde overlap At the same time the increase of absorbance at 475 ... it immediately to NMR analysis The H spectrum clearly demonstrated the appearance of an aldehydic proton at d ¼ 9.5 p.p.m and the 31P spectrum showed the release of a free phosphate at d ¼ 1.5 ... for The supernatant was extracted twice with ethyl acetate and the solvent was evaporated under vacuum The residual trichloroacetic acid and acetic acid released from the solvent were neutralized...
- 7
- 534
- 0
small business in paradise, working for yourself in a place you love (2007)
... San Francisco brokerage house, earning $400 a month At a time when Silicon Valley was still farmland and called Santa Clara Valley, David became an expert on the IPO market and technology startups ... year They immediately began plans for establishing the winery They hired Tri-Valley Vineyard Management again to manage and harvest the vineyard, and construction was begun on a new winery and tasting ... exhausted to manage the business For sake of comparison, the average national annual occupancy rate for all B&Bs is only about 40% However, that percentage averages all seasons of the year, and the difference...
- 242
- 676
- 0
small business in paradise, working for yourself in a place you love (2007)
... San Francisco brokerage house, earning $400 a month At a time when Silicon Valley was still farmland and called Santa Clara Valley, David became an expert on the IPO market and technology startups ... year They immediately began plans for establishing the winery They hired Tri-Valley Vineyard Management again to manage and harvest the vineyard, and construction was begun on a new winery and tasting ... exhausted to manage the business For sake of comparison, the average national annual occupancy rate for all B&Bs is only about 40% However, that percentage averages all seasons of the year, and the difference...
- 242
- 542
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose