optimally combining liquidity duration currency and non government risk by stephen j fisher and min c lie
Tài liệu An Empirical Decomposition of Risk and Liquidity in Nominal and Inflation- Indexed Government Bonds pptx
... bond risk premia and their components in order to better understand the economic significance of bond return predictability Specifically, we now compare the means and variances of predicted excess ... Review of Economic Studies 58, 495—514 Campbell, John Y., and Robert J Shiller, 1996, “A Scorecard for Indexed Government Debt”, In National Bureau of Economic Research Macroeconomics Annual 1996, ... 511—26 Pflueger, Carolin E., and Luis M Viceira, 2011, "Inflation-Indexed Bonds and the Expectations Hypothesis" forthcoming Annual Review of Financial Economics McCulloch, J Huston, and H Kwon, 1993,...
- 41
- 556
- 1
A cross national study of senior volunteerism in two non government organizations in singapore and p r china
... granted is just a phenomenon conditioned by a country’s circumstances The application of cross-national research could benefit researchers because it offers a chance for the researcher to see ... their current and former occupations, and factors such as personality and social and physical environment affect older people’s voluntary behaviours Fischer and Schaffer (1993) made a comprehensive ... lack of effective communication channels between policy makers and the citizens, the feeling of alienation and anomie among citizens, and the increasing pressure from citizens for better services,...
- 184
- 471
- 0
Tài liệu Báo cáo khoa học: "A High-Accurate Chinese-English NE Backward Translation System Combining Both Lexical Information and Web Statistics" pdf
... SScore ( C i , GN ) ⋅ LScore ( C i , GN ) LScore(Ci,GN) combines phonetic values and word senses to evaluate the lexical similarity between Ci and GN SScore(Ci,GN) concerns both recurrences information ... duplicate re-weighting and unnecessary verification There is one problem in verification we should concern Since we only consider recurrence information in both directions, but not cooccurrence ... is applied: EDA→B (0, t ) = t EDA→B (s,0) = s LScore (C i , GN ) = ∑all matched pairs GN ab and Cij LSim (GN ab , C ij ) , Total # of words in C i ∑ all matched pairs GN ab and Cij LSim...
- 8
- 569
- 0
Liquidity, Default, Taxes and Yields on Municipal Bonds docx
... curve modeling at the Bank of Canada, technical paper, Bank of Canada Brennan, M J. , T Chordia and A Subrahmanyam, 1998, Alternative factor specifications, security characteristics, and the cross-section ... The pricing formula above is not complete because it does not include the effect of liquidity risk, which is considered to be a critical factor for municipal bond pricing Liquidity is perceived ... 2006 by the Economic Growth and Tax Relief Reconciliation Act of 2001 The new tax law also increases the taxable income level for the 10% bracket Other effects of the 2003 tax act include child...
- 53
- 335
- 0
Working Paper No. 400 Liquidity-saving mechanisms and bank behaviour pot
... intraday liquidity and urgency threshold, settlement of payments takes place mechanically: banks receive payment instructions and process them according to urgency Costs are defined as in Galbiati and ... reception and execution of payment r with urgency ur Delay costs thus increase linearly with payment urgency The dependence of Ci on τi and on ‘others’ choices j comes via the delays, which ... liquidity needs, risks and efficiency in payment networks’, Bank of Finland Studies, E: 39 Martin, A and McAndrews, J J (2008), Liquidity- saving mechanisms’, Journal of Monetary Economics, Vol 55(3),...
- 28
- 351
- 0
Báo cáo khoa học: "Text Chunking by Combining Hand-Crafted Rules and Memory-Based Learning" pot
... Table 3: The simple statistics on STEP 2000 Korean Chunking dataset ặ ĩ éỉ Ô éỉ ộ ị ộ ị Đ ứ ặ êở ụỉ Đ ọ Â nq jcm nq ncn jcj mmd ncn ncn jxt ncn ncn nq jcm nq jca paa ef sf B-NP I-NP I-NP ... Golding and P Rosenbloom 1996 Improving Accuracy by Combining Rule-based and Case-based Reasoning, Articial Intelligence, Vol 87, pp 215254 T Joachims 1998 Making Large-Scale SVM Learning Practical, ... method Acknowledgement This research was supported by the Korean Ministry of Education under the BK21-IT program and by the Korean Ministry of Science and Technology under NRL and BrainTech programs...
- 8
- 393
- 0
The Duration of Bank Retail Interest Rates BY Ben R. Craig and Valeriya Dinger ppt
... shortcomings of cross-industry comparisons are that they cannot identify the impact of unobserved, industry-specific factors, they cannot control for firm- and industry-specific characteristics, and ... adjustment costs by including bank-specific and market-structure variables, such as the bank’s size, its market share and geographical scope, and the concentration of the market Our approach ... bank and local market characteristics Section employs competing risk models to study the determinants of asymmetric adjustments Section concludes Empirical Framework a Data Our dataset contains...
- 50
- 323
- 0
Federal Reserve Bank of New York Staff Reports: Bank Liquidity, Interbank Markets, and Monetary Policy pptx
... cij ( ; c1 ; ij r+ )= ij [ ij c1 (1 (1 ) )+ ij i ] ij : (6) The bank’ optimization can be written as s max 2[0;1] ;c1 ;f ij E[U ] gi2I ;j2 J (7) s.t ij cij ( ; c1 ; for i I; j J ij r+ )= ij [ ij ... the case of N states, as shown in the Appendix A 16 c2 1l(ρ) c2 0j( ρ) u(ctij) c2 1h(ρ) c1 (ρ) c1 (1) c1 (0) c2 0j( 0) c2 0j( 1) c2 1h(1) c2 1h(0) Figure 4: Equilibrium allocation for c2 1l(0) c2 1l(1) ctij(ρ) ... ) and = r): Arrows indicate the change in consumption between the suboptimal and the …rst best equilibria c2 0j (ρ) u(ctij) c2 1l(ρ) c2 1h(ρ) c1 (ρ) c1 (1) c1 (0) c2 0j (0) c2 1h(1) c2 1h(0) c2 0j (1) c2 1l(0)...
- 39
- 443
- 0
combining discrete orthogonal moments and dhmms for off-line handwritten chinese character recognition
... DHMMs-based character recognition system can be divided into two basic functional components: training and recognition Both training and recognition share a common pre-processing, frames generation and ... y'=y- (j- 1)xH Because the maximum order (n + m) is 3, a local Tchebiechef feature vector Tz(i j) or a local Krawtchouk feature vector Fz (i, j) extracting from a zone can be written as j) = {TOO(i ... in Table and Table It 3.5 The Acceleration of Feature Extraction According to (12), the computation of Trnm involves the computation of the function t (x) and p(n,N) And each function consists...
- 6
- 282
- 0
Báo cáo hóa học: " Non coding extremities of the seven influenza virus type C vRNA segments: effect on transcription and replication by the type C and type A polymerase complexes" ppt
... NS UCGUCUUCGUCUCCUAACCUU(UAC) UCGUCUUCGUCUCCUAA(UAC) UCGUCUUCGUCCCCUAGGCUU(UAC) UCGUCUUCGUCCCCCAAUUAU(UAC) UCGUCUUCGUCCUCUAAACCAAAAGUUUU(UAC) UCGUCUUCGUCCCCUGAAAAUUUGU(UAC) UCGUCUUCGUCCCCAUGAAAAAGUUU(UAC) ... AGCAGUAGCAAGGGGAUUUUUUCUUAUAAUGA(UCA) AGCAGUAGCAAGGGGAUUUUUGUUUUUUAUAAAACUGUACAAAAUAUUGACCAACACAUUAUCCAUUUUUCAAAA UUGUCUCAA(UCA) AGCAGUAGCAAGGAGAUUUUUGAAUUAUAUAUAGCAAUACAACAGUUGAUCAUAAAAUGUGCGAUGAAUUUAAUC UGACUUUAAUUUUCUCCAGGAAUGUUG(CUA) ... of the CAT RNA were as follows: sense CAT primer (6 s) 5'-GCTGGATATTACGGCCTTTTTAAA-3'; antisense CAT primer (5 as) 5'-ACCGTCTTTCATTGCCATACG-3'; and CAT probe 5'(FAM)-TATTCACATTCTTGCCCGCCTGATGAA(TAMRA)3'...
- 11
- 427
- 0
Báo cáo hóa học: " Selection combining for noncoherent decode-and-forward relay networks" pptx
... http://jwcn.eurasipjournals.com/content/2011/1/106 Recall that the destination selects only one signal among K received signals to decode The selected relay might forward a correct bit, an incorrect ... average SNR ¯ is γi ,j = Ei σi ,j /N0 With Rayleigh fading, the pdf of gi ,j is fi ,j (γi ,j ) = −γ i ,j/ γi ,j ¯ γi ,j e ¯ Nguyen and Nguyen EURASIP Journal on Wireless Communications and Networking 2011, ... Nguyen and Nguyen EURASIP Journal on Wireless Communications and Networking 2011, 2011:106 http://jwcn.eurasipjournals.com/content/2011/1/106 Destination Relay θ0,1 > θ rth Y N Discard Decode and...
- 10
- 346
- 0
Báo cáo sinh học: " Research Article Time-Frequency Data Reduction for Event Related Potentials: Combining Principal Component Analysis and Matching Pursuit" pot
... λ j PC j PCT , j Σ= (11) j =1 where λ j is the eigenvalue of each principal component PC j The principal components determine the span of the time-frequency space (5) Rotate the principal components ... Hertel, and W J Williams, Conscious and Unconscious Processes: Psychodynamic, Cognitive and Neurophysiological Convergences, Guilford Press, New York, NY, USA, 1996 [3] H Shevrin, W J Williams, ... J Racine, X U Yan, and C A Chapman, “Monitoring neuronal oscillations and signal transmission between cortical regions using time-frequency analysis of electroencephalographic activity,” Proceedings...
- 13
- 284
- 0
Báo cáo hóa học: " Research Article Identifying Genes Involved in Cyclic Processes by Combining Gene Expression Analysis and Prior Knowledge" pot
... data sets corresponding to the unicellular Saccharomyces cerevisiae and the multicellular Drosophila melanogaster The potential cell cycle and circadian rhythmic genes were identified and compared ... one-dimensional synchronization methods and fail to achieve a complete synchronization It is fully possible that the discovered periodicity is completely caused by chance or by the speci c synchronization ... and CCW12 in the cell cycle arrest experiments, we hypothesize that CCW12 is also cell cycle regulated at phase S/G2 All the detected 722 genes are hierarchically clustered in Figure The hierarchical...
- 9
- 253
- 0
Báo cáo hóa học: " A Robust Formant Extraction Algorithm Combining Spectral Peak Picking and Root Polishing" potx
... modeled by LP coefficients [1] Thus, by computing LP coefficients, we can model the vocal tract and obtain information on formants 2.1 Spectral peak picking method The spectral peak picking method and ... synthetic spectrum and the actual spectrum The synthetic spectrum is obtained using the approximated formant frequencies Thus, if the differences between the synthetic spectrum and the actual spectrum ... more accurate values that can reduce the above-mentioned differences between the synthetic and the actual spectra This process is performed using some systematic procedures, like dynamic programming...
- 16
- 270
- 0
Coin and Currency Dealer Newsletter - June 2012 By Doug West potx
... U.S Currency – (Regular issue U.S Currency from 1880’s forward, Colonial, Confederate States of America, Military Payment Certificates, Fractional Currency, Depression Scrip, Obsoletes,…) Selected ... increase in activity and prices Strong – noticeable increase in activity and prices ### About the author: Doug West is the senior numismatist at the family owned business C& D Coins and Currency ... Currency in Derby, Kansas Doug has over four decades of experience as a coin collector and dealer Doug is President of Wichita Coin Club, member of the American Numismatic Association, and Secretary/Treasurer...
- 3
- 119
- 0
Báo cáo y học: " Bedside measurement of changes in lung impedance to monitor alveolar ventilation in dependent and non-dependent parts by electrical impedance tomography during a positive end-expiratory pressure trial in mechanically ventilated intensive
... al Critical Care 2010, 14:R100 http://ccforum.com/content/14/3/R100 Page of Figure Principle of electrical impedance tomography (EIT) and the functional EIT image (fEIT) Electrical excitation currents ... of recruitable alveolar collapse and hyperdistension by electrical impedance tomography Intensive Care Med 2009, 35:1132-1137 Bikker et al Critical Care 2010, 14:R100 http://ccforum.com/content/14/3/R100 ... Bikker et al Critical Care 2010, 14:R100 http://ccforum.com/content/14/3/R100 on the measurement of lung tissue impedance by injection of small currents and voltage measurements, using electrodes...
- 9
- 299
- 0
Báo cáo y học: "Hepatitis B Virus (HBV) and Hepatitis C Virus (HCV) Dual Infection"
... seroclearance Int J Med Sci 2006, 60 Dual Infection of HBV and HCV and hepatocellular carcinoma (HCC) Conflict of interest HBV and HCV infections are confirmed causes of HCC What’s the combined ... effect of HBV and HCV coinfection on HCC? Accumulated epidemiological data suggested that coinfection with HBV and HCV could increase the risk for development of HCC A case-control study [51] conducted ... that occult infection may contribute to chronic liver damage and the development of HCC [32, 33, 34, 35] Cacciola [36] studied the prevalence and clinical significance of occult HBV infection...
- 6
- 621
- 1
Customer Service - Principles of Service Marketing and Management - C Lovelock & L Wright
... procedures are user-friendly and offer customers greater convenience Balancing Demand and Capacity In general, services that process people and physical objects are more likely to face capacity ... exclusively— those w h o are in direct contact with customers promotion and education: all communication activities and incentives designed to build customer preference for a specific service ... Latin American and Caribbean nations the service sector accounts service sector: the portion of a nations economy represented by services of all kinds, including those offered by public and non- profit...
- 387
- 1,194
- 6
Chemical bonding and molecular geometry( liên két hóa học và hình học phân tử)
... Library of Congress Cataloging-in-Publication Data Gillespie, Ronald J (Ronald James) Chemical bonding and molecular geometry from Lewis to electron densities / R.i Gillespie, P.L.A Popelier p cm -(Topics ... p cm -(Topics in inorganic chemistry) Includes bibliographical references and index ISBN 0-19-510496-X (ppk), 0-19-510495-1 (cloth) I Chemical bonds-History Molecules-Models I Popelier, P.L.A ... New York Athens Auckland Bangkok Bogota Buenos Aires Calcutta Cape Town Chennai Dar es Salaam Delhi Florence Hong Kong Istanbul Karachi Kuala Lumpur Madrid Melbourne Mexico City Mumbai Nairobi...
- 277
- 2,377
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25