only a written offer is legally valid
22. There is only a chair ............... leg was broken. a. whose b. which c. when d. that a 23. potx
... was the first black American to play baseball in the major leagues a whose b was c to play d the a Laser technology is the heart of a new generation of high-speed copiers and printer a is b a ... unvalued a 27 Harvesting has started earlier than usual It yet a hasn’t finished b didn’t finish c hadn’t finished d isn’t finishing a 28 This wine is much too dry Could I have a one, please? ... a 35 You gave me the example which is hardly to my situation a accustomed b entitled c valid d applicable d 36 the weather is cold, Annie isn't wearing a coat a Because b Although c Moreover...
- 43
- 575
- 0
3 Reasons Why Building a Lazy Downline is Smarter and More Profitable! Written By James 2 ppt
... "fill-in-the-blank" sales copy that targets their intended audience? A great example of this for us net marketers is a product that my friend Chris Zavadowski created It’s called InstantMLMSalesLetters.com ... thinking this way, you actually protect yourself from financial disaster should something happen to your MLM company fact is, many companies don’t last more than a few years In the pages that follow, ... such as legal, medical, or accounting The publisher wants to stress that the information contained herein may be subject to varying international, federal, state, and/or local laws or regulations...
- 18
- 380
- 0
Báo cáo y học: "Impaired glucose and nutrient absorption in critical illness: is gastric emptying only a piece of the puzzle" docx
... be a decreased plasma concentration of the molecule with a risk of misinterpretation of some important kinetic parameters (area under concentrationtime curve, maximal concentration, time to peak ... substances is often greater due to an increased capillary permeability resulting in fluid shifts from the intravascular compartment to the interstitial space Distribution volume may also be increased ... similar way to variables such as extracellular fluid volume or renal clearance enables calculation of urinary excretion ratios, thereby eliminating the effect of these factors [4] Another observation...
- 2
- 279
- 0
A novel interval method for validating state enclosures of the
... the words validated, guaranteed, and verified are used interchangeably to denote that state enclosures are mathematically and not only empirically proven to be correct Traditional validated techniques ... engineering are analysis and design of robust, optimal, and adaptive controllers For nonlinear systems, robustness analysis with respect to uncertain initial states and parameters can be performed by calculating ... proposed First, an approximate solution of an IVP similar to the considered one is calculated with exactly known initial states and parameters Based on this approximate solution, an easy-to-implement...
- 12
- 373
- 0
Tài liệu Retrieve Unique Records Using Only a Select Query docx
... this is the value of option button rbDistinct After the SQL string is created, it is assigned to lblSQLString to display the string, and then it is used in a data adapter to fill a dataset Last, ... build the data adapter and fill the data table Dim odaResults As New OleDb.OleDbDataAdapter(Me.lblSQLString.Text, _ BuildCnnStr("(local)", "Northwind")) Dim dtResults As New DataTable() odaResults.Fill(dtResults) ... creating the GenerateData routine This routine creates the necessary SQL SELECT statement based on whether blnUseDistinct is true or false If you look back at Listing 6.2, you will see that this...
- 6
- 200
- 0
Tài liệu Báo cáo khoa học: Expression of poly(A)-binding protein is upregulated during recovery from heat shock in HeLa cells doc
... gcattGTCGACttttttgtaaatttttttggggttttttaaaagatttttttagattttttttg gattttttCTGCAGCAGAGCTCGTTTAGTGAACCG Ccttctccccggcggttagtgctgagagtgc aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa Primer ... PCMV-Sport–b-gal plasmid) CGCTATTACCATGGTGATGC (nucleotides 4588–4608 of PCMV-Sport–b-gal plasmid) CGGTTCACTAAACGAGCTCTGCTGCAGaaaaaatccaaaaaaaatctaaaaaaatcttttaaaa aaccccaaaaaaatttacaaaaaaGTCGACaatgc gcattGTCGACttttttgtaaatttttttggggttttttaaaagatttttttagattttttttg ... Journal compilation ª 2008 FEBS S Ma et al (1) β-gal CMV Transcription start site C β-gal (2) ARS-β-gal CMV Transcription start site β-gal AR S 5’-aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa-3’...
- 19
- 596
- 0
Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt
... 5¢-GCTTCAGTACTTAGAGAC 5¢-TAATACGACTCACTATAGGGAGACGTAGCACGTTACACC 5¢-GAAAAAAGGGGCCACTCAGG 5¢-T(18)GAAAAAAGGGGCCACTCAGG 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTG 5¢-C(18)GAAAAAAGGGGCCACTCAGG 5¢-G(18)GAAAAAAGGGGCCACTCAGG ... Forward Reverse Reverse Reverse Forward Reverse 5¢-TAATTAACCCTCACTAAAGGGGTGCTCGGCATAAG 5¢-GCCATGAATATCTCCAACGAG 5¢-CATCCAAAATACGCCATGAATATC 5¢-TAATACGACTCACTATAGGGGCCGCTTAACGTCGCG 5¢-GCTTCAGTACTTAGAGAC ... 5¢-G(18)GAAAAAAGGGGCCACTCAGG 5¢-GAATTGCTGCCGTCAGCTTGA 5¢-TAATTAACCCTCACTAAAGGGAAACGGAGCGGCACCTCTT 5¢-GCGGATCCTGGACCGCAAAAG ompA* ompA105 ompA117 5¢rpsO 5¢rpsO 3¢rpsO 3¢rpsO 3¢rpsO-(T)18 rpsO internal 3¢rpsO-(C)18...
- 10
- 488
- 0
Tài liệu Báo cáo khoa học: Transcription of individual tRNA1Gly genes from within a multigene family is regulated by transcription factor TFIIIB pdf
... FEBS A Parthasarthy and K P Gopinathan completely abolished when the TATATAA sequence was mutated to GATATCA (lanes 3, 4) These results were also consistent with the observation that TFIIIB alone ... was analysed by electrophoresis on 4% polyacylamide (nondenaturing) gels and visualized in a Phosphorimager Lanes as marked The heparin-resistant complex on tRNA1Gly -1 (left) is marked by an ... Regulation of pol III transcription A Parthasarthy and K P Gopinathan and making them unavailable for transcription The ‘TATATAA’ sequence present in the flanking regions Gly of tRNA1 -6,7 was responsible...
- 15
- 484
- 0
Tài liệu Báo cáo khoa học: "Detection of Japanese Homophone Errors by a Decision List Including a Written Word as a Default Evidence" docx
... increases Our method has an advantage that the size of DL1 is smaller The size of the decision list has no relation to the precision and the recall, but a small decision list has advantages of ... DL1 is, DL1 is the decision list to attach the written word as the default evidence to a (see Fig.l) Next, we calculate the precision and the recall of DL1 Because a of DL1 is the same as that ... strength that gives the m a x i m u m F-measure in a training corpus As a result, our decision list can raise the F-measure of error detection Homophone disambiguation decision list by a In this section,...
- 8
- 588
- 0
Báo cáo khoa học: Expression of the Drosophila melanogaster ATP synthase a subunit gene is regulated by a transcriptional element containing GAF and Adf-1 binding sites pptx
... 365–377 Biswas, G., Adebanjo, O .A. , Freedman, B.D., Anandatheerthavarada, H.K., Vijayasarathy, C., Zaidi, M., Kotlikoff, M & Avadhani, N.G (1999) Retrograde Ca2+ signaling in C2C12 skeletal myocytes ... by PCR from total DNA using the primers pADm1 (forward; 5¢-AGCAGTCGACGA AGCGACGAAGTGAAGCTGCGTGA-3¢) and pADm3 (reverse; 5¢-ATCCGTCGACATGCTTTTTAACTGTT CG-3¢) After digestion with SalI (which recognizes ... d-aminolevulinate synthase (ALAS) and b-F1-ATPase genes [29,34] In both constructs there was a substantial Fig Functional analysis of the D melanogaster a- F1-ATPase promoter Scheme of the a- F1-ATPase promoter...
- 11
- 532
- 0
Báo cáo khoa học: Tumor necrosis factor-a converting enzyme is processed by proprotein-convertases to its mature form which is degraded upon phorbol ester stimulation pptx
... following antibodies were used: anti-ADAM10, a polyclonal rabbit antibody against endogenous ADAM10 and anti-TACE, and a polyclonal rabbit antibody against endogenous TACE (Chemikon International, ... 25–31 Takahashi, S., Kasai, K., Hatsuzawa, K., Kitamura, N., Misumi, Y., Ikehara, Y., Murakami, K & Nakayama, K (1993) A mutation of furin causes the lack of precursor-processing activity in human ... (5¢-GTGGGCCGGAAAGTGAGCCA-3¢) and Fur2_rev (5¢-CCCTTGTAGGAGATGAGGCC-3¢) The resulting 1058 bp amplificate was isolated, subcloned in pUC57 (MBI Fermentas) and sequenced Western blot analysis of TACE and ADAM10...
- 8
- 422
- 0
Báo cáo khoa học: "Shallow parsing on the basis of words only: A case study" pptx
... is easier than finding grammatical relations as we tag a headword of a chunk as e.g a subject in isolation whereas grammatical relation assignment also includes deciding which verb this chunk is ... with a fixed training set size might present a misleading snapshot Second, the amount of training material available today is already enough to make words more valuable input than (gold-standard!) ... learning (Stanfill and Waltz, 1986; Aha et al., 1991; Daelemans et al., 1999b) is a supervised inductive learning algorithm for learning classification tasks Memory-based learning treats a set of labeled...
- 8
- 657
- 0
Báo cáo khoa học: R120G aB-crystallin promotes the unfolding of reduced a-lactalbumin and is inherently unstable ppt
... [11], and closely followed the discovery that a naturally occurring mutation at the equivalent position in aA-crystallin, R116C, caused congenital cataract in humans [12] In aA-crystallin and aB-crystallin, ... (where aA-crystallin is mainly located), but, because aB-crystallin also has considerable extralenticular distribution, it is perhaps not surprising that the R120G aB-crystallin mutant is responsible ... bated at 25 °C for up to 16 days, and aliquots were sampled at regular intervals for analysis by MS and SDS ⁄ PAGE No degradation of wild-type aB-crystallin was observed after a 9-day incubation,...
- 14
- 366
- 0
Information security audit (IS audit) - A guideline for IS audits based on IT-Grundschutz pptx
... between IS cross-cutting audits and IS partial audits An IS cross-cutting audit has a holistic approach and a wide range of tests and examinations In an IS cross-cutting audit, all layers of ... international organisations such as the International Auditing and Assurance Standards Board (IAASB) or the Institute of Internal Auditors (IIA) These publications take IT, as an important component ... Informationstechnik 19 IS audit in the organisation advantage that knowledge of complex organisational structures and procedures is available However, many organisations not have the necessary...
- 38
- 505
- 0
Báo cáo khoa học: SLC39A14, a LZT protein, is induced in adipogenesis and transports zinc pptx
... GAGCAT-3¢ or 5¢-CTTCTTGGGGAAACATG-3¢, and a reverse primer: 5¢-CCAGCATAATGGAGAAGC-3¢, 5¢-AA CTGGACCCTAAGCCTA-3¢ or 5¢-ACTGGATCCTAGGT GATC-3¢ 5¢-RACE was performed using a Marathon cDNA Amplification ... resultant double-stranded cDNA was ligated to a Marathon cDNA adapter by T4 DNA ligase The PCR for 5¢-RACE was performed using the forward primer AP-1: 5¢-CCATCCTAATACGACTCACTAT AGGGC-3¢ and a SLC3 9A1 4-specific ... Hybond-N+ nylon membrane (Amersham Pharmacia Biotech Ltd, Piscataway, NJ, USA) Each probe was labeled with [32P]dCTP[aP] using a BcaBEST labeling kit (Takara Biomedicals, Kusatsu, Japan) Cell culture...
- 10
- 323
- 0
probability and finance it's only a game
... popular, this way of talking is not encouraged by our framework What is a stochastic mechanism? What does it mean to suppose that a phenomenon, say the weather at a particular time and place, is ... PROBABILITY AND FINANCE AS A GAME Our framework is a straightforward but rigorous elaboration, with no extraneous mathematical or philosophical baggage, of two ideas that are fundamental to both probability ... game is terminating A strategy simulates a transaction satisfactorily for Skeptic if it produces at least as good a net payoff Table 1.2 summarizes how this applies to buying and selling a variable...
- 417
- 426
- 0
the unfinished revolution how a new generation is reshaping family work and gender in america dec 2009
... especially Michael Armato, Stephanie Byrd, Sarah Damaske, Adam Green, Pamela Kaufman, Allen Li, and Louise Roth, also offered valued feedback Over the years they have taught me as much as I taught ... when at least one parent had a flexible work arrangement and a child had access to good child care As a firefighter, Daniel’s father was able—and eager—to far more than just fill in at home: She wasn’t ... Hannah listened to her mother regularly complain—and blame her father—about lost chances and roads not taken: I hear about this ad nauseam! My mother was the first woman in the state to be in agricultural...
- 312
- 381
- 0
báo cáo hóa học:" A practical approach for the validation of sterility, endotoxin and potency testing of bone marrow mononucleated cells used in cardiac regeneration in compliance with good manufacturing practice" docx
... 85(3):221-228 Tateishi-Yuyama E, Matsubara H, Murohara T, Ikeda U, Shintani S, Masaki H, Amano K, Kishimoto Y, Yoshimoto K, Akashi H, Shimada K, Iwasaka T, Imaizumi T: Therapeutic angiogenesis for patients ... with limb ischaemia by autologous transplantation of bonemarrow cells: a pilot study and a randomised controlled trial Lancet 2002, 360(9331):427-435 Miyamoto K, Nishigami K, Nagaya N, Akutsu K, ... Bossolasco P, Deliliers GL: Differentiation and expansion of endothelial cells from human bone marrow CD133(+) cells Br J Haematol 2001, 115(1):186-194 Asahara T, Masuda H, Takahashi T, Kalka C, Pastore...
- 9
- 773
- 0
báo cáo hóa học:" A MIF haplotype is associated with the outcome of patients with severe sepsis: a case control study" pdf
... Cerami A, Bucala R: MIF is a pituitary-derived cytokine that potentiates lethal endotoxaemia Nature 1993, 365:756-759 Calandra T, Bernhagen J, Mitchell RA, Bucala R: The macrophage is an important ... correction was applied for single marker analysis Statistical significance was assumed at p < 0.05 Statistical power (1-β) was calculated using binominal power calculation The power calculation for ... malarial anemia J Infect Dis 2009, 200:629-637 Dhanantwari P, Nadaraj S, Kenessey A, Chowdhury D, Al-Abed Y, Miller EJ, Ojamaa K: Macrophage migration inhibitory factor induces cardiomyocyte apoptosis...
- 8
- 554
- 0
báo cáo hóa học: " Integration of immigrants into a new culture is related to poor sleep quality" pptx
... whether this finding is related to cultural or nutritional factors It is also possible that the generally more active hypothalamic-pituitary-adrenal axis in women contributes to a greater variability ... and supervised the interviewers, carried out the statistical analyses and drafted the manuscript Inka Tuin conceived of the study, participated in its coordination and the statistical analysis, ... flexible approach to handle stress: information is preferred in situations that are controllable through early intervention By contrast, distraction and avoidance (blunting) are practiced in situations...
- 6
- 435
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008