oligo a tails are longer in the presence of hfq
Đề tài " Axiom A maps are dense in the space of unimodal maps in the Ck topology " doc
... construction of the domains A0 and B0 that at the point r the boundaries of Ax0 and B x0 are tangent to each other and that this tangency is quadratic We will look for the map h0 near the point r in the ... in the 2-to-1 way onto the domain A (so that there is a critical point of g in the central domain), • All other components of B are mapped univalently onto A by the map g, • The iterates of the ... component of the domain B Then the ratio |Akl +1 | |Akl | tends to exponentially fast, where |Ak | is the length of the real trace of the domain Ak Here the real trace of the domain is just the intersection...
- 44
- 412
- 0
Characteristics of flow in the wake region of a bluff vertical cylinder in the presence of waves,currents and combined wave current flows 2
... 114 of Chapter Based on the above observations, it is clear that the spatial features of the flow around and in the wake of the bluff upstream cylinder remain invariant over successive wave period ... in the wake of the upstream bluff cylinder The mapped kinematics in the cylinder wake show that beat phenomenon occurred over a sizable region in the wake of the upstream cylinder, at domain ... spectra plots that wave current interaction in the wake is enhancing turbulence in the wake 188 Table 23: Position Spectra of kinematics in the wake of the upstream cylinder, measured at x =...
- 108
- 275
- 0
Characteristics of flow in the wake region of a bluff vertical cylinder in the presence of waves,currents and combined wave current flows 1
... where (a) local wave elevations and forces on the downstream cylinder are measured in the two cylinder runs, (b) local wave elevations and downstream kinematics are measured in the single cylinder ... cylinder is a slender cylinder The area of interest is in the flow characteristics around and in the wake of a bluff upstream cylinder, where the focus is on the presence of beat phenomenon To investigate ... 104 By varying the ratio of Uc / Uw, from to 1, it was ascertained that: a The forces on the in- line direction of the cylinder varies in a same manner as the flow velocity, for the range of Uc...
- 195
- 474
- 0
Characteristics of flow in the wake region of a bluff vertical cylinder in the presence of waves,currents and combined wave current flows 3
... velocities measured at y = offset, at spacing of (a) ½ D, (b) D, and (c) ½ D for combined wave and currents of T = 0.7 s, H = 25 mm, C = 50 mm/s 319 Plots of Kinematics in the Wake of Upstream Cylinder ... measured at y = 0.6 D offset, at spacing of (a) ½ D, (b) D, and (c) ½ D for combined wave and currents of T = 0.7 s, H = 25 mm, C = 50 mm/s 320 Plots of Kinematics in the Wake of Upstream Cylinder ... velocities measured at y = offset, at spacing of (a) ½ D, (b) D, and (c) ½ D for combined wave and currents of T = 0.7 s, H = 25 mm, C = 50 mm/s 321 Plots of Kinematics in the Wake of Upstream Cylinder...
- 64
- 231
- 0
Characteristics of flow in the wake region of a bluff vertical cylinder in the presence of waves,currents and combined wave current flows 4
... (At Stable Beating Downstream cylinder spacing at x = ½ D, y = 0.6 D) Figure H8 Iso surface plots of wave only run, T = 0.7s, at time intervals of T (At Steady State Downstream cylinder spacing ... T=0.7s, at time intervals of T’ (At Stable Beating Downstream cylinder spacing at x = ½ D, y = 0) Figure H12 Iso surface plots of wave only run, T = 0.7s, at time intervals of T’ (At Steady State ... surface plots of wave and currents run, C =50mm/s, T =0.7s, at time intervals of T’ (At Stable Beating Downstream cylinder spacing at x = ½ D, y = 0.6 D) Figure H6 Iso surface plots of wave and...
- 57
- 228
- 0
Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx
... MPTP alone The apparent rate constant of aggregation in the presence of dopamine was significantly higher (0.25 h)1) than in the presence of MPTP alone (0.096 h)1) This indicates a faster rate of ... Department of Biotechnology (Govt of India) for partial financial support The authors thank Dinesh Kumar for recording the scanning electron micrographs and Shivcharan Prasad and Pinakin Makwana for ... urea Effect of dopamine on MPTP and MPP+ induced changes in kinetics of the aggregation of a- synuclein a- Synuclein was incubated in the presence of 100 lm MPTP, along with 50 lm dopamine Aliquots...
- 11
- 754
- 0
Báo cáo khoa học: Kinetic analysis of zymogen autoactivation in the presence of a reversible inhibitor pptx
... indicating that the dominant effect of the Ca2+ concentration appears Fig Autocatalytic activation of trypsinogen by trypsin in the absence or presence of p-amindinobenzamidine (A) Effect of trypsinogen ... trypsinogen autoactivation in the presence of 100 lM p-amindinobenzamidine As seen in this figure, the presence of p-amindinobenzamidine lengthened the lag time considerably Similarly, the values of ... Trypsin catalyzes the activation of trypsinogen in an intermolecular autocatalytic process The conversion of trypsinogen to trypsin involves the removal of the N-terminal hexapeptide H2N-Val-AspAsp-Asp-Asp-Lys...
- 8
- 403
- 0
Báo cáo khoa học: "What’s There to Talk About? A Multi-Modal Model of Referring Behavior in the Presence of Shared Visual Information" potx
... explore these parameters in detail Second, we plan to appreciably enhance the integrated model It appears from both our initial data analysis, as well as our qualitative examination of the data, that ... We also extend these models to a new task domain that can elaborate on referential patterns in the presence of various forms of shared visual information Finally, we make use of a corpus gathered ... understanding of human referring behavior in the presence of shared visual information They suggest that shared visual information of the task objects and surrounding workspace can significantly...
- 8
- 567
- 0
Báo cáo khoa học: Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates potx
... TGCCATGAAGATCTTAGA TGAGCAGTACTACGCCATGA GTAGCCCTGCTGGTCAATGA TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CCTAATGCCCACCAATCCA (VI) TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CTAATCTATGAAATGGCAG ... splice variants (Pfu Ultra system; Stratagene) Upper primer 5¢-CACCGCCG CCACCATGGGATTGTCACGCAAATCATCAGATGC ATCT-3¢ and lower primer 5¢-TTAAAATTCACCA AATTCTTTTGCACATT-3¢ yielded Cb3ab and Cb3abD4, ... Supplementary material The following supplementary material is available online: Fig S1 Comparison of human and Rhesus monkey PKA Cb amino acid sequence This material is available as part of the online...
- 13
- 344
- 0
Báo cáo "Thermomechanical characteristics of rigid poly(vinyl chloride) crosslinked by a peroxide in the presence of trimethylolpropane trimethacrylate " pdf
... with increasing concentration of TMPTMA up to 15 phr Therefore, in order to obtain PVC having the highest , 0.4 phr of DAPC and phr of TMPTMA can be used in the material Table 2: Linear thermal ... crosslinked by DAPC and TMPTMA, the sample containing 0.2 phr of DAPC and 15 phr of TMPTMA has the minimum Ts Used PVC contains a network of crystallites (8.6%), which act as physical crosslinks, and ... This can be also explained by the presence of TMPTMA as a plasticizer It improves the molecular mobility, melting and softening of PVC and a result, Ts decreases with increasing Table 1: Softening...
- 5
- 377
- 0
Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot
... draft the manuscript AlexP participated in the design of the study and drafted the manuscript Both authors read and approved the final manuscript Acknowledgements 18 19 The authors thank Prof ... recombination awaits further investigation Conclusion The data presented in this paper show that the recTULV presents no real match to the original cell adapted variant and that the lower fitness of the ... presence of TULV S RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855) To monitor the presence of...
- 5
- 483
- 0
báo cáo hóa học:" Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" ppt
... draft the manuscript AlexP participated in the design of the study and drafted the manuscript Both authors read and approved the final manuscript Acknowledgements 18 19 The authors thank Prof ... recombination awaits further investigation Conclusion The data presented in this paper show that the recTULV presents no real match to the original cell adapted variant and that the lower fitness of the ... presence of TULV S RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855) To monitor the presence of...
- 5
- 430
- 0
Báo cáo hóa học: "A new low-complexity angular spread estimator in the presence of line-of-sight with angular distribution selection" pptx
... V-array: an antenna array (a) Two antenna elements of an antenna array at the base station with antenna elements at the base station (c) An antenna array with antenna elements at the base station ... The same reasoning is adopted for the ASs estimates (19) One can argue that the mean of the AS estimates could be used instead of the standard deviation in (19) Actually, the mean of the obtained ... dik sin θik (7) λ In this study, we are interested in estimating the mean AoA and the AS In other terms, we determine the mean and the standard deviation of the angular ditribution of the received...
- 16
- 487
- 0
báo cáo hóa học: " Topological confinement in an antisymmetric potential in bilayer graphene in the presence of a magnetic field" pptx
... perpendicular external magnetic field, both for the case of a single potential kink, as well as for a kink-antikink pair One advantage of such a setup is the fact that in an experimental realization of ... the sequence alignment and drafted the manuscript GAF contributed in analysis of the numerical results All authors read and approved the final manuscript Competing interests The authors declare ... corresponding to the states that are indicated by arrows in panel (a) (a) (b) Figure Energy levels of a single kink profile in bilayer graphene as function of external magnetic field B0 with the same...
- 10
- 471
- 0
báo cáo hóa học:" Research Article Entire Solutions for a Quasilinear Problem in the Presence of Sublinear and Super-Linear Terms" potx
... Boundary Value Problems The class of problems 1.1 appears in many nonlinear phenomena, for instance, in the theory of quasiregular and quasiconformal mappings 1–3 , in the generalized reaction-diffusion ... no 2, pp 498–505, 1996 13 A V Lair and A W Shaker, “Classical and weak solutions of a singular semilinear elliptic problem,” Journal of Mathematical Analysis and Applications, vol 211, no 2, pp ... fluids are called pseudoplastics; if p Newtonian and if p > the fluids are called dilatants It follows by the nonnegativity of functions a, b, f, g of parameter λ and a strong maximum principle that...
- 16
- 438
- 0
Báo cáo hóa học: " Research Article A Two-Stage Approach for Improving the Convergence of Least-Mean-Square Adaptive Decision-Feedback Equalizers in the Presence of Severe " doc
... complexity of the system; only M +1 of the total 2M + tap weights are adapted In the scenario where there is a phase and/or gain error, the system requires the use of either training symbols to adapt the ... (17) The autocorrelation matrix seen in (17) is partitioned into submatrices The matrices on the diagonal are the autocorrelation matrix of the received input to the equalizer and the Note that the ... stages associated with the adaptive algorithm The first stage is the training phase, where known training symbols are used to push the filter in the direction of the optimal weights After the training...
- 13
- 365
- 0
báo cáo khoa học: " Peritonitis secondary to traumatic duodenal laceration in the presence of a large pancreatic pseudocyst: a case report" ppsx
... his stomach His abdominal cavity was lavaged with copious warm saline, a drain placed adjacent to the gastrojejunostomy and a drain by the duodenal repair and his abdomen closed The drains were ... abdominal trauma in the presence of a large pancreatic pseudocyst Minor blunt abdominal trauma in a normal healthy adult would not be expected to result in any significant duodenal injury We acknowledge ... and amended the manuscript LCT provided the photographs obtained at the time of surgery All authors read and approved the final manuscript Competing interests The authors declare that they have...
- 4
- 251
- 0
Báo cáo y học: " Isolated radial head dislocation, a rare and easily missed injury in the presence of major distracting injuries: a case report" ppsx
... Chapman MW, Felix N: Traumatic anterior dislocation of the radial head in an adult J Orthop Trauma 1995, 9(5):441-4 Yasuwaki Y, Itagane H, Nagata Y, Nishimoto S, Nakano A, Tanaka S: Isolated lateral ... dislocated radial head Figure Radiograph of the elbow showing a dislocated radial head Radiograph of the elbow showing a dislocated radial head to the forearm [3] although Bonatus et al speculated ... supination gave a favourable final outcome In the presence of major distracting injuries like long bone fractures, pelvic fractures, chest and abdominal injuries, an isolated radial head dislocation...
- 3
- 373
- 0
Báo cáo y học: "Successful renal re-transplantation in the presence of pre-existing anti-DQ5 antibodies when there was zero mismatch at class I human leukocyte antigen A, B, & C: a case report" doc
... RA, Zachary AA: The changing role of antibody testing in transplantation Clin Transpl 2005:259-271 Freedman BI, Thacker LR, Heise ER, Adams PL: HLA-DQ matching in cadaveric renal transplantation ... amounts after transplantation These antibodies were measured using antigen-specific beads from One Lambda and a Luminex analyzer (Austin, TX, USA) After the transplant, our patient received rabbit antihuman ... write the manuscript MS, MV, and CL cared for the patient and provided clinical details Acknowledgements The authors thank Ms Kathy Trueman for preparation of the manuscript and figures, and the...
- 4
- 418
- 0
Báo cáo y học: "B-lymphocyte stimulator/a proliferation-inducing ligand heterotrimers are elevated in the sera of patients with autoimmune disease and are neutralized by atacicept and B-cell maturation antigen-immunoglobulin" pdf
... were then resuspended in 100 μl of assay buffer and analyzed by using a Luminex 100 machine (Luminex Corporation, Austin, TX, USA) The total assay time was hours The assay had a broad range (~100 ... rheumatoid arthritis (RA), BLyS and APRIL are overexpressed in the synovial fluid as well as in the sera [6,16] Preliminary data suggest that BLyS/ APRIL heterotrimers also are elevated in patients ... speculate that native A2 B trimers are likely capable of binding to TACI and BCMA, whereas AB trimers should predominantly bind to TACI and possibly BAFF-R Dillon et al Arthritis Research & Therapy...
- 14
- 460
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25