numbers heat of combustion why vegetable oils and their derivatives are suitable as a diesel fuel
Báo cáo khoa học: The oxidative effect of bacterial lipopolysaccharide on native and cross-linked human hemoglobin as a function of the structure of the lipopolysaccharide A comparison of the effects of smooth and rough lipopolysaccharide ppt
... pH range from 5.3 to Tsuruga and Shikama [21] confirmed that the fast phase of oxidation was due to the a chains and the slow phase was due to the b chains Tsuruga et al found that the beta chain ... of pH on the auto-oxidation of Hb A0 has been the subject of several studies Mansouri and Winterhalter [5] reported that the oxidation of the a chains of Hb A0 was 10 times faster than that of ... initial fast phase of the reaction, but decreased the rate of the slow phase of oxidation in the presence of EDTA A comparison of rough and smooth LPSs of E coli and S minnesota in the presence of...
- 6
- 748
- 0
Báo cáo khoa học: Mechanisms of amyloid fibril self-assembly and inhibition Model short peptides as a key research tool pptx
... information of the role of aromatic moieties in amyloid fibril formation [36–41] A parameter-free model based on the mathematical analysis of many peptide fragments and their analogues had clearly ... similar to aromatic DNA-intercalating agents Although DNA is the most important biological assembly stabilized by aromatic interactions [56], a diverse group of planar aromatic compounds can intercalate ... peptide and the full-length IAPP assemblies had similar cytotoxic activity showed, for the first time, that a peptide as small as a hexapeptide can form a well-ordered and functional amyloid structure...
- 8
- 440
- 0
GROWTH PERFORMANCE AND SPERM QUALITY OF STRESS NEGATIVE PIÉTRAIN BOARS AND THEIR HYBRIDS WITH DUROC
... be realized exactly at months and 7.5 months of age, actual ages of animals (days) at measurement were added in the model as a covariate For the sperm quality, the different genetic groups and ... indicate major bias Although the semen quality of PiDu75 boars was lower than other hybrid boars, it was similar to PiCT All semen traits of stress-negative Piétrain boars as well as hybrid boars ... Wysokinska, A. , S Kondracki, D Kowalewski, A Adamiak, E Muczynska (2009) Effect of seasonal factor on the ejaculate properties of crossbred DurocxPiétrain and PiétrainxDuroc boars as well as purebred...
- 6
- 734
- 0
Characteristics of Leachate from Citrus Groves and their Changes in the Collecting Reservoirs in Matsuyama, Japan
... Osaka, Kobe, Hiroshima, and others Therefore, it is considered that a large amount of pollutants runs into the sea from the urban as well as industrial areas As the area around the Seto Inland ... Inland Sea on its west, which is one of the largest closed water areas in Japan and has required water purification for a long period Aside from this, there are many small reservoirs in and around ... surveyed in detail and material balances around reservoirs were considered RESEARCH PROCEDURE Location: Matsuyama region and periphery of the Seto Inland Sea The location of the research area and the...
- 10
- 717
- 0
Biochemical characterization of thermophilic lignocellulose degrading enzymes and their potential for biomass bioprocessing
... both cellulase and xylanase activity A 35 kDa protein was reported for a T aurentiacus cellulase [62], a B subtilis B230 xylanase [63] and a Postia placenta multienzyme cellulase and xylanase complex ... Baharuddin A. S., Razak M.N .A. , Hock L.S., Ahmad M.N., Abd A. S., Rahman N .A. A., Shah U.K.M., Hassan M .A. , Sakai K., Shirai Y Isolation and characterization of thermophilic cellulaseproducing bacteria from ... Wisconsin, Madison, USA He has served as vice chair of the Biomass Energy and Industrial Products committee, and associate editor of Transactions of the ASABE Kasi’s research interests are in food...
- 14
- 525
- 0
A study of the linguistic features of suggestion verbs in english and their vietnamese equivalents
... out the similarities and differences between the syntactic features of ESVs and VSVs - Analyzing data of ESVs and VSVs in terms of the semantic features and making a contrastive analysis to find ... requestives and advisories In fact, the complication and the diversity of the structures and the meaning nuances of SVs are clear Table 4.52 A Summary of Structures of ESVs and Their Vietnamese Equivalents ... The analysis results of ESVs and VSVs are examined and compared in each category in an attempt to find out the similarities and differences between the two languages 3.7 RELIABILITY AND VALIDITY...
- 13
- 1,330
- 5
A study of semantic and syntactic features of english famous love sayings and their vietnamese translation
... beliefs, arts, morals, law, custom, and any other capabilities, and habits acquired by man as a member of a society” ♦ Relation of Culture and Language The relationship between language and culture are ... faithful ♦ Negative Sides of Love : They are divided into scales 18 Love is a disappointment and suffering Love is jealousy and hatred Love and money are hand in hand Man and woman in love are ... Implications for Teaching and Learning EFLSs and Their Vietnamese Translation As mentioned, the findings of this thesis are the syntactic and semantic features of EFLSs and their Vietnamese translation...
- 26
- 1,159
- 3
Tài liệu an analySiS of euro area Sovereign CDS anD their relation With government bonds docx
... Netherlands, Austria and Belgium the cash market has a predominant role in price discovery In the case of Italy, Ireland, Spain, Greece and Portugal CDS markets are playing a major role in terms of ... measures In contrast, for Greece, Ireland, Italy, Portugal and Spain which on average have lower bases, the interaction dummy indicates an overall negative impact of the amount of bonds outstanding ... group of countries given by Italy, Ireland, Spain, Portugal and Greece The data sources are Bloomberg, Federal Reserve Bank of New York and Datastream Notation Definition Sign Basis (-1) Lagged basis...
- 49
- 1,460
- 0
Tài liệu Báo cáo khoa học: Post-translational modifications of the linker histone variants and their association with cell mechanisms docx
... data for chicken were taken from [44] Chicken H101 H110 H102 H103 H11L H11R H5 a- S a- S a- S a- A a- S a- A a- pT T T T pT T pT pS A A A A A A A A A A A P – pS P P P P A A – P A S A A A P A A A A A ... a- T a- pS a- pS a- S a- pS a- pS N pT A T pT pT pS A A A A A A A A A A E aK S A P P P – aK aK 2mK K K – P A pT pT pS – aK K K K K – mK K K K K K A mK T K K K K R R R mR S K a ⁄ mK a ⁄ mK mK mK D A ... a- S a- pS N T T T T T S V A A A A A A A A A E – S A P P P – K aK aK aK aK – P A pT pT pS – aK K K K K – K K K K K K P A K A K K K R R R R S K aK aK aK K D A pS pS pS T S S S S S S A Q auK auK auK...
- 13
- 633
- 0
Tài liệu Báo cáo khoa học: Identification of ATP-NADH kinase isozymes and their contribution to supply of NADP(H) in Saccharomyces cerevisiae docx
... yef1-attB1FSD AAAAAGCAGGCTCCGAAGGAGATATAAAA ATGAAAACTGATAGATTACTG AGAAAGCTGGGTGGATTGCAAAATGAGCCTGAC ACAAGTTTGTACAAAAAAGCAGGCT ACCACTTTGTACAAGAAAGCTGGGT CAATAAATCTGCTTACGTGACATTTTTTACTAAAAGAGAAT ATGCGTACGCTGCAGGTCGAC ... TTAATCGATGAATTCGAGCTCG CATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAA ATGCCAATTCTGTGTTTCCCGGAAATG CTTAGAGAATCTCATTGAATCTTTGCATTCAGAGCGT TTAGTAAAGTTCGTTTGCCGATACATG CGTTATGAAAATCACTATTATCCCC AAAAGCTTAGATTGCAAAATGAGCCTGACGA ... ATGCGTACGCTGCAGGTCGAC GAACCCTTGACTACGGAAACGCAGGATGTGGGAAATCG TTAATCGATGAATTCGAGCTCG CATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAA ATGCGTACGCTGCAGGTCGAC CTTAGAGAATCTCATTGAATCTTTGCATTCAGAGCGT TTAATCGATGAATTCGAGCTCG...
- 13
- 560
- 0
Tài liệu An International Comparison of Milk Supply Control Programs and Their Impacts pot
... The US and New Zealand have both significantly increased their share of the world market, while the EU and Canadian shares have been declining Australia’s share has also declined, but that has been ... declining as their production is limited by quota Canada’s share has dropped to 1% as their export subsidies are capped Drought and falling milk production has decreased Australia’s share of the ... has outpaced the EU-15 and Canada Europeans have traditionally been large dairy consumers, and they consume more fluid milk, cheese, and butter per capita than Canadians or Americans Canadian...
- 83
- 436
- 0
Báo cáo khoa học: Comprehensive sequence analysis of horseshoe crab cuticular proteins and their involvement in transglutaminase-dependent cross-linking potx
... Antibacterial Antibacterial Antibacterial Antibacterial Antibacterial Antibacterial Antibacterial Antibacterial Unknown Antibacterial Antibacterial Antibacterial Antibacterial Antibacterial Unknown ... Kawabata S, Nagayama R, Hirata M, Shigenaga T, Agarwala KL, Saito T, Cho J, Nakajima H, Takagi T & Iwanaga S (1996) Tachycitin, a small granular component in horseshoe crab hemocytes, is an antimicrobial ... DNA sequence analysis [62] Rapid amplification of cDNA ends (RACE) Analysis by 5¢- and 3¢-RACE was performed using a SMARTTM RACE cDNA amplification kit (Clontech Laboratories, Palo Alto, CA, USA)...
- 13
- 582
- 0
Báo cáo khoa học: Identification of microsomal rat liver carboxylesterases and their activity with retinyl palmitate potx
... TCGGCAGCACTACATTGTCAAC-3¢; ES3 5¢- GAGTCTCCGTGCAAATCCAGCG-3¢; D50580 5¢-TGTTCTTCAGAACAGCCCGCATG-3¢; AB010635 5¢-CAGCGGGAATCATCTTGAAGACC-3¢ and for AY034877 5¢-AGGCCCAGGAACACAGGGATTCC-3¢ The specificity of oligonucleotides ... stained for activity and the activity bands for corresponding peaks are labeled with arrows In this gel, peak appeared as a doublet (band a and b) Each peak was further separated on nondenaturing ... was identified, cloned and sequenced Marathon Ready rat liver cDNA, anchor primers AP1 and AP2 (Clontech, Palo Alto, CA, USA), and gene specific primers 5¢-AGGCCCAGGAACGGGATTCC-3¢ for 5¢ RACE and...
- 12
- 439
- 0
Báo cáo Y học: Properties of group I allergens from grass pollen and their relation to cathepsin B, a member of the C1 family of cysteine proteinases pdf
... G lamblia cathepsins 1–3 (U83275, U83276 and U83277, respectively) and G gallus cathepsin B (U18083) Areas of identity are boxed, and areas of similarity are shaded Binding epitopes for mAb HB7 ... 139 when compared with the proteinases of G lamblia and G gallus All Cys and Trp residues are absolutely conserved in a- expansins and b-expansins as well as in the C1 cysteine proteinases Other ... (N-terminal), IG12 (central) and Bo14 (C-terminal) are marked Important conserved cysteine residues and other essential amino acids are numbered Areas of high similarity exist around Cys69 and Cys72 and...
- 10
- 535
- 0
Polymer assisted synthesis of aligned amorphous silicon nanowires and their core shell structures with au nanoparticles
... No 2003 AA305670) and ÔTop Hundred Talents ProgramÕ of Chinese Academy of Sciences for financial support Appendix A Supplementary material Supplementary data associated with this article can be ... formly absorbed on the surface of the SiNWs Because of the high standard electrode potential of the Au3+/Au0 couple, Au3+ has high polarization and high chemical reactivity Au3+ could be easily ... dispersed Au nanoparticles were obtained by heating them upto 300 °C at a rate of °C/ and keeping them at that temperature for h under Ar atmosphere in a seal pyrolysis quartz tube The morphology and...
- 5
- 467
- 0
ON THE TRANSFORMATION PROCESSES OF THE GLOBAL PULP AND PAPER INDUSTRY AND THEIR IMPLICATIONS FOR CORPORATE STRATEGIES – A European perspective pot
... kannattavuudesta Pohjois-Amerikassa ja Euroopassa Yritykset ovat joutuneet sulkemaan ylikapasiteettia, karsimaan kustannuksia ja divestoimaan ydinliiketoimintaan kuulumattomia yksiköitä, ja yleisesti ... kannattavuuden paranemiseksi Muutosprosessin ajureina toimivat korkea pääomatarve, kypsä elinkaaren vaihe, kasvun maantieteellinen jakaantuminen, kuidun saatavuus ja hinta, korvaavat tuotteet, alhainen arvonmuodostus ... arvonmuodostus koko arvoketjussa sekä globaalilla tasolla alhainen konsolidaatioaste, jotka johtavat kysynnän ja tarjonnan epätasapainoon ja heikkoon kannattavuuteen Teollisuuden strategiset toimenpiteet...
- 219
- 483
- 0
BENEFITS OF E-CRM FOR BANKS AND THEIR CUSTOMERS pdf
... (Mosad, 1995) Employees who are friendly and cooperative and careful at handling customer’s data availability of customers’ information and staff for assistance 45 DATA ANALYSIS Trust Michael ... advance At the same time to enhance and improve the reliability of the work we have maintained a database where we have saved up all the articles, which are very well published and are available ... explained that all the transactions are secure with the usage of security authenticator Transactions are recorded, bank governs statements of transactions and their security As far as transaction...
- 73
- 710
- 0
Báo cáo khoa học: Identification of rice TUBBY-like genes and their evolution Qingpo Liu docx
... to search the local and Oryza sativa protein database in NCBI with an e-value of 10 Moreover, a psi-blast search against the nonredundant GenBank database was performed to collect tubby domain-containing ... domain Experimental evidence has shown that AtTLP1, AtTLP2, AtTLP3, AtTLP6, AtTLP7, AtTLP9, AtTLP10 and AtTLP11 are expressed in all tested organs, whereas AtTLP5 and AtTLP8 are tissue specifically ... protein name: Aa, Aedes aegypti; Ag, Anopheles gambiae; Am, Apis mellifera; At, Arabidopsis thaliana; Bt, Bos taurus; Ca, Cicer arietinum; Cb, Caenorhabditis briggsae; Ce, Caenorhabditis elegans;...
- 9
- 381
- 0
báo cáo hóa học: " Occurrence of post traumatic stress symptoms and their relationship to professional quality of life (ProQoL) in nursing staff at a forensic psychiatric security unit: a cross-sectional study" potx
... rate of PTSD symptoms at ward A Generally, compared to normative data, mean Compassion Satisfaction scores (CS) were low at all the wards At ward A; mean CS was 30.2, (SD 6.5) Ward B; mean = ... length of psychiatric nursing experience, which of the wards you were working at (as categorical variable) and scoring on the variables Compassion Satisfaction (CS), Burnout (BO) and Compassion Fatigue ... health among Hungarian health care staff: a questionnaire survey Int J Nurs Stud 2006, 43(3):311-318 Inoue M, Tsukano K, Muraoka M, Kaneko F, Okamura H: Psychological impact of verbal abuse and...
- 6
- 449
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008