0

nfκb activation by wedelolactone a selective inhibitor of ikkα and ikkβ

Báo cáo y học:

Báo cáo y học: "Tetra-O-methyl nordihydroguaiaretic acid (Terameprocol) inhibits the NF-B-dependent transcription of TNF-a and MCP-1/CCL2 genes by preventing RelA from binding its cognate sites on DNA" ppsx

Báo cáo khoa học

... CGG ATA GAT 3’; sense: 5’ ACT CCC TCA AGA TTG TCA GCA AT 3’]; TNF -a [antisense: 5’ AGA AGA GGC ACT CCC CCA AAA 3’; sense: 5’ CCG AAG TTC AGT AGA CAG AAG AGC G 3’]; MCP-1/CCL2 [sense: 5’ CAC TAT ... (5’-AACAGGGGGCTTTCC-3’) and antisense (5’AGGAGGGAAAGCCCC-3’), and mutant TNF -a B3 sense (5’-AACAGGGGGCTGAGCCTC-3’) and antisense (5’-GAGGCTCAGCCCCCTGTT-3’) Statistical Analysis All graphs and ... TNF -a: (forward:5’-TCTCAAGCTGCTCTGCCTTC-3’; reverse:5’CACCAGGATTCTGTGGCAAT-3’) RANTES/CCL5: (Forward:5’-TGGAGGGCAGTTAGAGGCAGAG-3’; reverse:5’-AGCCAGGGTAGCAGAGGAAGTG-3’) and MCP-1/CCL2:(Forward:5’-ATTCTTCCCTCTTTCCC...
  • 11
  • 622
  • 0
Tài liệu Báo cáo khoa học: Solution NMR structure of five representative glycosylated polyene macrolide antibiotics with a sterol-dependent antifungal activity doc

Tài liệu Báo cáo khoa học: Solution NMR structure of five representative glycosylated polyene macrolide antibiotics with a sterol-dependent antifungal activity doc

Báo cáo khoa học

... polyene macrolides of this study (Fig 4, right) Structural analysis of vacidin A The number of experimental restraints available [32] was large for vacidin A, and the 29 final models appear well ... of the 1H and 13C resonances of nystatin A1 and rimocidin in neat methanol-d4 (Table 1) were carried out based on the identification of various unambiguous resonances These signals were used as ... Volpon and J.-M Lancelin (Eur J Biochem 269) Table Structural statistics for the pimaricin and nystatin A1 ˚ Cartesian coordinate rmsd (A) vs the average geometric structurea pimaricin nystatin A1 ...
  • 9
  • 522
  • 0
Tài liệu Báo cáo Y học: Ornithine decarboxylase-antizyme is rapidly degraded through a mechanism that requires functional ubiquitin-dependent proteolytic activity pot

Tài liệu Báo cáo Y học: Ornithine decarboxylase-antizyme is rapidly degraded through a mechanism that requires functional ubiquitin-dependent proteolytic activity pot

Báo cáo khoa học

... was then added and the mixture was incubated in the dark After 12 h of incubation 100 lL of proline (100 mgÆmL)1) was added and the mixture was incubated for an additional h Dansylated derivatives ... 33 Kahana, C & Nathans, D (1985) Translational regulation of mammalian ornithine decarboxylase by polyamines J Biol Chem 260, 15390–15393 34 Kahana, C & Nathans, D (1985) Nucleotide sequence of ... Kitani, T & Fujisawa, H (1989) Purification and characterization of antizyme inhibitor of ornithine decarboxylase from rat liver Biochim Biophys Acta 991, 44–49 43 Fujita, K., Murakami, Y & Hayashi,...
  • 7
  • 382
  • 0
Báo cáo khoa học: Characterization of the bga1-encoded glycoside hydrolase family 35 b-galactosidase of Hypocrea jecorina with galacto-b-D-galactanase activity pdf

Báo cáo khoa học: Characterization of the bga1-encoded glycoside hydrolase family 35 b-galactosidase of Hypocrea jecorina with galacto-b-D-galactanase activity pdf

Báo cáo khoa học

... in arabinogalactan degradation may also explain why bga1 expression and that of the Leloir pathway genes gal1 (encoding galactokinase) and gal7 (encoding galactose-1-phosphate uridylyltransferase) ... Switzerland) and galactan from lupin and potato was from Megazyme (Bray, Ireland) Strain and culture conditions To purify the extracellular b-galactosidase, H jecorina strain PKI-BGA13, a recombinant ... otherwise, all substrates and peptides and proteins for MS calibration were purchased from Sigma (St Louis, MO) and at least of analytical grade Arabinogalactan was purchased from Fluka (Buchs,...
  • 10
  • 351
  • 0
Báo cáo khoa học: Lending a helping hand, screening chemical libraries for compounds that enhance b-hexosaminidase A activity in GM2 gangliosidosis cells pptx

Báo cáo khoa học: Lending a helping hand, screening chemical libraries for compounds that enhance b-hexosaminidase A activity in GM2 gangliosidosis cells pptx

Báo cáo khoa học

... thermostable and has a basic pI, and Hex S (aa) is thermolabile and has an acidic pI Only the Hex A and B isozymes are easily detectable in normal human tissue In Tay-Sachs disease, Hex B levels increase ... monomeric GM2 activator protein (Activator), which acts as a substrate specific cofactor for Fig Late-onset Tay-Sachs disease or Sandhoff disease associated mutations evaluated for enhancement by enzyme ... data became understandable a few years later with the characterization of the ER quality control system (ER-QC) and its endoplasmium reticulum-associated degradation pathway (ERAD) [13] To pass...
  • 11
  • 348
  • 0
Báo cáo khoa học: Selection of peptides inhibiting a b-lactamase-like activity docx

Báo cáo khoa học: Selection of peptides inhibiting a b-lactamase-like activity docx

Báo cáo khoa học

... °C for 1.5 Taq DNA polymerase was purchased from New England Biolabs The forward primer AB 348, 5¢-TTAGCAAAACCTC ATACAGAA-3¢, and the backward primer AB 349, 5¢-GATGCTGTCTTTCGCTGCTGAG-3¢, were ... the biocatalyst and, on the other hand, valuably inhibit a b-lactamase-like activity shown by an anti-idiotypic catalytic Ig By this approach, we reduced the diversity of the original library from ... resonance Phage ELISA appeared to be an efficient qualitative assay However, it cannot be used to measure accurate Kd values because the affinity of the Ig for phage particles probably takes part of the...
  • 7
  • 428
  • 0
Báo cáo y học:

Báo cáo y học: "Increased interleukin-17 production via a phosphoinositide 3-kinase/Akt and nuclear factor κB-dependent pathway in patients with rheumatoid arthritis" ppt

Báo cáo khoa học

... phosphorylated Akt as shown with antiCD3, which was an inhibition by wortmannin and PDTC as well as by LY294002 (data not shown) Activation of the NF-κB and activator protein-1 (AP-1) pathway in ... and leukemia inhibitory factor by synoviocytes, and of prostaglandin E2 and nitric oxide by chondrocytes, and has the ability to differentiate and activate the dendritic cells [8-10] Levels of ... were analyzed for Akt activation by western blot analysis of total and Ser473-phosphorylated Akt (P-Akt) using specific antibodies Levels of phosphorylated Akt were compared at each time point, after...
  • 10
  • 346
  • 0
Báo cáo y học:

Báo cáo y học: "Tumor necrosis factor-alpha promotes survival in methotrexate-exposed macrophages by an NF-B-dependent pathwa" pptx

Báo cáo khoa học

... Kotake S, Udagawa N, Hakoda M, Mogi M, Yano K, Tsuda E, Takahashi K, Furuya T, Ishiyama S, Kim KJ, Saito S, Nishikawa T, Takahashi N, Togari A, Tomatsu T, Suda T, Kamatani N: Activated human ... synthesis and accumulation of AICAR AICAR, by inhibiting enzymatic deamination of adenosine and adenosine monophosphate, is proposed to increase availability of adenosine extracellularly, for anti-inflammatory ... stabilization of IkappaBalpha can facilitate its re-synthesis and prevent sequential degradation J Cell Physiol 2003, 195:470-478 Nasu K, Nishida M, Ueda T, Yuge A, Takai N, Narahara H: Application...
  • 13
  • 511
  • 0
Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

Báo cáo khoa học

... from genomic DNA of B xenovorans LB400 through a PCR with GAGCGGCATATGGA AATCAAACCGAAGGTTCGCGA and GAGCGGCATA TGGAAATCAAACCGAAGGTTCGCGA as the forward and reverse oligonucleotide primers, respectively ... metal–ligand distances (Table 2) compare very favorably with data in the protein database, from ˚ which an average distance of 2.03 A for Fe–N(His) was inferred [38], and a target distance of ... display a remarkably conserved structure [2,17–19] A facial triad of two histidines and one carboxylate residue (aspartate or glutamate), exemplified by the metal centers of a large class of 2-ketoglutarate-dependent...
  • 15
  • 624
  • 0
Tài liệu Báo cáo khoa học: Regulation of cathepsin B activity by 2A2 monoclonal antibody docx

Tài liệu Báo cáo khoa học: Regulation of cathepsin B activity by 2A2 monoclonal antibody docx

Báo cáo khoa học

... activity of cathepsin B Results Preparation and characterization of 2A2 mAb and its Fab fragments 2A2 mAb (41.3 mg) was isolated and purified from hybridoma cell medium Fab fragments prepared by papain ... of Abz-GIVRAK(Dnp)-OH (final concentration lm) and 10 lL of 2A2 mAb or NaCl ⁄ Pi were added to a well of a black microtiter plate and the reaction was initiated by adding 85 lL of activated cathepsin ... of cathepsin B activity B A B C Fig Characterization of cathepsin B neutralizing 2A2 mAb and its Fab fragment (A) SDS ⁄ PAGE of the Fab fragment (lane 2); low molecular weight standards (lane...
  • 13
  • 417
  • 0
Tài liệu Báo cáo khoa học: Dual P2Y12 receptor signaling in thrombin-stimulated platelets – involvement of phosphoinositide 3-kinase b but not c isoform in Ca2+ mobilization and procoagulant activity pdf

Tài liệu Báo cáo khoa học: Dual P2Y12 receptor signaling in thrombin-stimulated platelets – involvement of phosphoinositide 3-kinase b but not c isoform in Ca2+ mobilization and procoagulant activity pdf

Báo cáo khoa học

... represented the ATP- and thapsigargin-sensitive phosphatase activity Measurement of Akt activation Akt activation was measured by western blot analysis, using a phosphoserine-473 Akt polyclonal antibody ... supplementary material is available online: Fig S1 Proposed role of the P2Y12 receptor in regulating Ca2+ signaling and platelet procoagulant activity This material is available as part of the online article ... (Biosource International, Camarillo, CA, USA) to detect active Akt kinase, as well as a separate Akt polyclonal antibody (Cell Signaling Technology, Danvers, MA, USA) to determine total Akt, as described...
  • 15
  • 565
  • 0
Tài liệu Báo cáo khoa học: Glycation of low-density lipoprotein results in the time-dependent accumulation of cholesteryl esters and apolipoprotein B-100 protein in primary human monocyte-derived macrophages docx

Tài liệu Báo cáo khoa học: Glycation of low-density lipoprotein results in the time-dependent accumulation of cholesteryl esters and apolipoprotein B-100 protein in primary human monocyte-derived macrophages docx

Báo cáo khoa học

... using BSA as a standard Data analysis Data are expressed as mean ± SEM from three or more separate experiments with triplicate samples One-way or two-way analysis of variance (anova) was used ... supported by grants from the Diabetes Australia Research Trust and the Australian Research Council B E Brown and I Rashid gratefully acknowledge receipt of Australian Postgraduate Awards administered ... lipid loading in primary human macrophages, primarily via the scavenger receptors SR -A and CD36 The accumulation of lipid in these macrophages is accompanied by increased endocytosis and degradation...
  • 12
  • 604
  • 0
Tài liệu Báo cáo khoa học: Design, structure and biological activity of b-turn peptides of CD2 protein for inhibition of T-cell adhesion ppt

Tài liệu Báo cáo khoa học: Design, structure and biological activity of b-turn peptides of CD2 protein for inhibition of T-cell adhesion ppt

Báo cáo khoa học

... cross-peaks, and were assigned as strong, medium and weak ˚ represent the family Based on ROE violation > 0.2 A and allowed values of /, w in the Ramachandran map, only one family of structure that ... fulfilled: (a) the conformation of backbone had an interproton error of less ˚ than 0.2 A compared to upper and lower boundaries of distances from ROE/NOE data and (b) the conformation had / angles ... (San Diego, CA, USA) The pure product was analyzed by HPLC and fast atom bombardment mass spectrometry (FABMS) The HPLC chromatogram showed that the purities of peptides were more than 90%, and...
  • 14
  • 657
  • 0
Tài liệu Báo cáo khoa học: The Alzheimer b-peptide shows temperature-dependent transitions between left-handed 31-helix, b-strand and random coil secondary structures doc

Tài liệu Báo cáo khoa học: The Alzheimer b-peptide shows temperature-dependent transitions between left-handed 31-helix, b-strand and random coil secondary structures doc

Báo cáo khoa học

... fragments Ab(19) and Ab(1228) (Fig 3) indicate that residues 28 begin in a PII-rich average conformation at C, move towards a b-strand conformation at 2030 C, and nally towards random coil at ... N-terminal fragment Ab(19), whereas the C-terminal half is dominated by random coil already at low temperature seen directly by comparing the CD spectra of Ab(140) and Ab(128), Fig 1A, B At high ... negative values of /), until a minimum of / is reached, after which the values start to increase again A random coil secondary structure represents a weighted average of all allowed dihedral angles...
  • 12
  • 287
  • 0
Tài liệu Báo cáo khoa học: Molecular characterization and allergenic activity of Lyc e 2 (b-fructofuranosidase), a glycosylated allergen of tomato pdf

Tài liệu Báo cáo khoa học: Molecular characterization and allergenic activity of Lyc e 2 (b-fructofuranosidase), a glycosylated allergen of tomato pdf

Báo cáo khoa học

... sequence of the coding region: 5¢TTAC AAGGACAAATTAATTGTGCCAG For amplification of the long isoform the same 5¢ primers were used, the 3¢ specific primer was FF3B: 5¢TTACAAGTCTTGCAA AGGGAAGGAT For amplification ... We also found reactivity of some sera to a 9- and a 15-kDa band We could show that the 9-kDa band in the tomato extracts reacts with a specific antibody against the LTP from cherry, Pru av and ... Chemical Company, Edegem, Belgium) Analysis and identification of the glycans was carried out by mass spectrometry using a DYNAMO MALDI-TOF (Thermo´ BioAnalysis, Santa Fe, NM, USA) Sera from patients...
  • 11
  • 533
  • 0
Tài liệu Báo cáo Y học: Characterization and regulation of yeast Ca2+-dependent phosphatidylethanolamine-phospholipase D activity docx

Tài liệu Báo cáo Y học: Characterization and regulation of yeast Ca2+-dependent phosphatidylethanolamine-phospholipase D activity docx

Báo cáo khoa học

... These data indicate that the pattern and extent of stimulation of the membrane and soluble yeast PtdEtnPLD activity by Ca2+ and their inhibition by other divalent cations is highly comparable The ... which was followed by a second peak of activation after 70 The activity then declined gradually to near basal levels after 2, and h (Fig 5A) PtdEtn-PLD activity similarly exhibited a transient ... cellular localization The stimulation of PtdEtn-PLD by Ca2+ ions is biphasic This pattern raises the possibility that Ca2+ may have a dual mechanism of action in activating PtdEtn-PLD, e.g Ca2+ may...
  • 10
  • 499
  • 0
Báo cáo khoa học: The N-terminal hybrid binding domain of RNase HI from Thermotoga maritima is important for substrate binding and Mg2+-dependent activity pot

Báo cáo khoa học: The N-terminal hybrid binding domain of RNase HI from Thermotoga maritima is important for substrate binding and Mg2+-dependent activity pot

Báo cáo khoa học

... prepared by hybridizing lm of the 5¢-FAM-labeled 12 base RNA (5¢-cggagaugacgg-3¢), 29 base DNA13-RNA4(5¢-AATAGAGAAAAAGaaaaAAGATGGCAA DNA12 AG-3¢), 29 base DNA15-RNA1-DNA13 (5¢-AATAGAGAA AAAGAAaAAAGATGGCAAAG-3¢) ... maritima MSB8, which was obtained from the American Type Culture Collection (Manassa, VA, USA), was used as a template The sequences of the PCR primers are 5¢- TGGGTTTGAGAGCATATGAAGTTGG CAAAAAAATACTAC-3¢ ... spectra The far- and near-UV CD spectra of Tma-RNase HI, Tma-CD and Tma-ND were measured at 20 °C and pH 9.0, and comparisons are shown in Fig The farand near-UV CD spectra of Tma-CD are similar...
  • 16
  • 459
  • 0
Báo cáo khoa học: Autocatalytic processing of procathepsin B is triggered by proenzyme activity doc

Báo cáo khoa học: Autocatalytic processing of procathepsin B is triggered by proenzyme activity doc

Báo cáo khoa học

... mutant: R54N, E5 9A, D6 0A) ; 5¢-CCAG AACGTTATGTTTGCAGCTGCACTGAAGCTGCCTGC-3¢ (for the TED58AAA mutant: R54N, T5 8A, E5 9A, D6 0A) ; 5¢-CCCAGAACGTTATGGCTGCAGCTGCACTGAAGC TGCCTG-3¢ (for the FTED57AAAA ... deletion of E59 and D60) as a template and mutagenic primers: 5¢-CCAGAACGTTCCGTTTGCACTGAA-3¢ (for T58ADED_M56P mutant: R54N, M56P, T5 8A, deletion of E59 and D60) and 5¢-GAACGTTATGCCGGCACTGA AGCT-3¢ ... mutant: R54N, F5 7A, T5 8A, E5 9A, D6 0A) ; 5¢-CCAGAACGTTATGGC TACCGAGGACCTGAAGC-3¢ (for the F5 7A mutant: R54N, F5 7A) ; 5¢-CCAGAACGTT(GC)CGTTTACCGA GG-3¢ (a degenerate primer for M5 6A and M56P mutants;...
  • 9
  • 425
  • 0
Báo cáo khoa học: Analysis of the NADH-dependent retinaldehyde reductase activity of amphioxus retinol dehydrogenase enzymes enhances our understanding of the evolution of the retinol dehydrogenase family pot

Báo cáo khoa học: Analysis of the NADH-dependent retinaldehyde reductase activity of amphioxus retinol dehydrogenase enzymes enhances our understanding of the evolution of the retinol dehydrogenase family pot

Báo cáo khoa học

... for all-trans-retinal Retinoids were quantitated by comparing their peak areas with a calibration curve constructed from peak areas of a series of standards The peak detection limit was about ... however, that cofactor ratios vary greatly among organs and cell types, and that the redox status can be greatly influenced by external factors [32] Noticeably, amphioxus enzymes have the capacity ... (PAN2) [13–17], MDR-ADH forms such as ADH1, ADH4 [18] and amphibian ADH8 [19], and members of the aldo-keto reductase superfamily, including human aldose reductase (AR), human small intestine aldose...
  • 14
  • 477
  • 0

Xem thêm