na h exchanger isoform 1 attenuates mitochondrial cytochrome c release in cortical neurons following in vitro ischemia pdf
Reactive oxygen species mediated regulation of the na+ h+ exchanger, NHE 1 gene expression a new mechanism for tumor cells resistance to apoptotic cell death
... transporters (Cl HCO3- exchanger, Na+ - HCO3- cotransporter) Na+ -driven Cl HCO3- exchanger couples an influx of Na+ and HCO3- to an efflux of Cl- and H+ (so that NaHCO3 comes in and HCl goes out) A Na+ -independent ... H+ -lactate co-transporter, (B) H+ Channel, (C) Cl HCO3- exchanger, (D) Na+ -H+ exchanger, (E) Na+ driven Cl HCO3- exchanger (F) Na+ -HCO3- cotransporter 20 regulator in transformed cells NHE isoform ... re-perfusion Increased Na+ that gets accumulated in the cell activates the Na+ /Ca++ exchanger Na+ then leaks out of the cell in exchange for Ca++ ions Increased concentration of Ca++ ions in the myocardium...
- 155
- 399
- 0
Regulation of na+ h+ exchanger 1 (NHE1) stability in PTEN mouse embryonic fibroblasts
... epithelial cells 10 AT1 MCF10AT1 pre-malignant breast epithelial cells Akt Protein kinase B CA1a MCF10CA1a malignant breast epithelial cells CA 1h MCF10CA 1h malignant breast epithelial cells CHP Calcineurin ... Akt phosphorylation in MCF10AT1Kcl.2 series of breast cancer cell lines 11 7 Figure 34: NHE1 protein stability studies in cells in MCF10A1, MCF10AT1, MCF10CA1a and MCF10CA 1h 12 3 Figure ... Thr Threonine xiii CHAPTER 1: INTRODUCTION 1. 1 Na+ /H+ exchanger- 1 (NHE1) 1. 1 .1 NHE1 isoforms and NHE1 structure The regulation of intracellular pH (pHi) is a tightly regulated parameter that has...
- 214
- 258
- 0
Regulation of na+ h+ exchanger 1 (NHE 1) gene expression by mild oxidative stress
... during cardiac ischemia Activation of this exchanger is coupled with sodium influx which results in an increase of the intracellular calcium level by the Na+ /Ca2+ exchanger The elevated and accumulation ... maintenance of transformed phenotypes (Reshkin et al., 2000b) Moreover, a recent finding shows that the oncogenic protein nucleophosminanaplastic lymphoma kinase (NPM-ALK) induce an alkaline intracellular ... excitation-contraction coupling in the heart (Petrecca et al., 19 99) It was revealed that NHE -1 accumulates at the intercalated disks in close proximity to the predominant cardiac gap junction protein connexin 43...
- 288
- 272
- 0
Báo cáo Y học: Properties of the Na+/H+ exchanger protein Detergent-resistant aggregation and membrane microdistribution potx
... being in fraction 12 As an alternative method of examining NHE1 colocalization with lipid rafts we used immunocytochemical staining of NHE1 in combination with cholera toxin staining of GM1 gangliosides ... another independent method of determining the Na+ /H+ exchanger localization we used immunocytochemistry We found that the Na+ /H+ exchanger colocalized with GM1 as indicated by cholera toxin staining ... role of cysteine residues in the Na+ /H+ exchanger Arch Biochem Biophys 358, 11 6 12 4 10 Moor, A.N & Fliegel, L (19 99) Protein kinase mediated regulation of the Na+ /H+ exchanger in the rat myocardium...
- 9
- 433
- 0
Báo cáo khoa học: Microcin J25 induces the opening of the mitochondrial transition pore and cytochrome c release through superoxide generation doc
... mediated by an increase of the matrix calcium concentration, with the concomitant release of cytochrome c The fact that the mitochondrial swelling induced by MccJ25 was inhibited by antimycin A allowed ... would induce a small increase in the internal calcium concentration, which in turn activates the uniporter of calcium, increasing even more the calcium in ux and ROS production Both the increase ... of intramitochondrial calcium concentration and the opening of MTP trigger mitochondrial swelling, with the concomitant release of the apoptotic inducer cytochrome c [24] The sequence of these...
- 9
- 286
- 0
Báo cáo Y học: Permeability transition-independent release of mitochondrial cytochrome c induced by valinomycin ppt
... not induced at least at this stage Release of mitochondrial cytochrome c induced by valinomycin Finally, we examined whether cytochrome c is released from mitochondria when they are treated with ... of mitochondrial cytochrome c, which is present on the outer surface of the inner membrane, could occur even under the condition in which a PT at the inner mitochondrial membrane was not induced ... Thus, in this study, we examined the release of cytochrome c from isolated mitochondria by valinomycin As a result, we found valinomycin to induce a significant release of mitochondrial cytochrome...
- 7
- 272
- 0
Báo cáo khoa học: Structure of a trypanosomatid mitochondrial cytochrome c with heme attached via only one thioether bond and implications for the substrate recognition requirements of heme lyase potx
... euglenozoan cytochrome c could structurally accommodate two cysteines in a typical CXXCH heme-binding motif (Fig 3) So, how might the occurrence of these single cysteine cytochromes c be explained? Considerable ... of the AXXCH heme-binding motif, which is found in place of the first cysteine of a typical c- type cytochrome CXXCH hemebinding motif expected [ 21] ) covalently attached to the protein through its ... that cytochrome c biogenesis System II can catalyze single cysteine heme attachment within the four-heme c- type cytochrome NrfH from Wolinella succinogenes which is unrelated to mitochondrial cytochrome...
- 11
- 513
- 0
Báo cáo khoa học: Lysosomal enzymes promote mitochondrial oxidant production, cytochrome c release and apoptosis docx
... abundance of reducing agents which could counteract this) Cytochrome c is involved in the activation of caspase-9 [7,46] and is considered a key component of the apoptotic cascade Ordinarily, any cytochrome ... peroxidase-dependent chemiluminescence was detected by using enhanced chemiluminescence Western blotting reagents and hyperfilm according to the manufacturer’s instructions (Amersham Pharmacia Biotech) Statistical ... rupture but could also have the secondary effect of maintaining any cytochrome c released by the mitochondria in the oxidized form (although we should note that the cellular cytoplasm contains an...
- 9
- 190
- 0
báo cáo khoa học: " An unedited 1.1 kb mitochondrial orfB gene transcript in the Wild Abortive Cytoplasmic Male Sterility (WA-CMS) system of Oryza sativa L. subsp. indica" ppt
... orfB gene RACE AMP GCGGCCACGGATCCGTCGAC 62 C 3’ RACE primer Corf GTCAGGATCCGGTGCTAAAACCTTTTCTC 62 C 3’ Gene-specific primer for 5’ RACE of orfB gene and RT-PCR AAP GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG ... of 1. 1 kb specific northern probe Mtg -1 TCGAGAGCTCGGATAATCCGCATCAAGAAG 62.5 C 5’ Gene-specific primer for preparation of 1. 1 kb specific northern probe and RT-PCR FP-24 CGCCAGGGTTTTCCCAGTCACGAC ... atp9-3’ CGGCGAGCTCCTATTTGCAAAGAGAGATATC 63 C PCR primer for the atp9 gene probe atpA-5’ ATATCTGCAGCATGGAATTCTCACCCAGAGCTGG 66 C PCR primer for the atpA gene probe atpA-3’ AGCAGGATCCGAAGCGGTGGCTGCTACAA...
- 18
- 336
- 0
Báo cáo khoa học: Dictyostelium differentiation-inducing factor-1 induces glucose transporter 1 translocation and promotes glucose uptake in mammalian cells pdf
... n.s * * 1. 6 * 1. 4 1. 2 0.8 T HPH THPH n.s 1. 8 DIF -3 1. 3 1. 2 1. 1 0.9 Tg DIF-3 DIF -1 1.5 1. 4 1. 3 1. 2 1. 1 0.9 B 1. 7 1. 6 1. 5 1. 4 1. 3 1. 2 1. 1 0.9 DIF -1 Basal 1. 5 1. 4 1. 3 1. 2 1. 1 0.9 Relative in ten ... a speci c inhibitor for the calmodulin-dependent cyclic nucleotide phophodiesterase, PDE1 [19 ] We thus examined the effects of two [Ca2+ ]c- increasing agents, thapsigargin (an inhibitor of Ca2+-ATPase ... RGM -1 cells were incubated for 14 h with 15 –30 lM DIF -1, the incubation media were discarded, and all the cells were incubated with fresh media in the absence of EtOH or DIF -1 for 12 h The glucose...
- 13
- 430
- 0
Báo cáo khoa học: The mitochondrial permeability transition from in vitro artifact to disease target ppt
... Transitional Ca2+ release Arch Biochem Biophys 19 5, 468–477 Mitchell P (19 79) Keilin’s respiratory chain concept and its chemiosmotic consequences Science 206, 11 48 11 59 Garlid KD (19 88) Mitochondrial ... conveying electrical and calcium signals Cell 89, 11 45 11 53 11 9 Schultheiss HP & Klingenberg M (19 84) Immunochemical characterization of the adenine nucleotide translocator Organ specificity and conformation ... PK 11 195, 1- (2-chlorophenyl)N-methyl-N- (1- methylpropyl)-3-isoquinolinecarboxamide I In vitro studies Life Sci 32, 18 39 18 47 15 5 Hirsch T, Decaudin D, Susin SA, Marchetti P, Larochette N, Resche-Rigon...
- 23
- 345
- 0
ỨNG DỤNG MÔ HÌNH GÂY NHIỄM THỰC NGHIỆM CHUẨN ĐÁNH GIÁ ẢNH HƢỞNG CỦA β-1,3/1,6-GLUCAN VÀ VITAMIN C LÊN ĐỘ MẪN CẢM ĐỐI VỚI VIRUS GÂY HỘI CHỨNG ĐỐM TRẮNG (White spot syndrome virus-WSSV) CỦA TÔM SÚ (Penaeus monodon)
... c n thiết nhằm tăng c ờng đáp ứng miễn dịch tôm chống lại mầm bệnh 2.3 .1 Chất kích thích miễn dịch Chất kích thích miễn dịch h p chất h a h c có khả làm tăng h at tính tế bào bạch c u chúng giúp ... chất kích thích tăng c ờng h miễn dịch tôm Đi từ sở th c tiễn đó, đƣ c phân c ng môn C ng Nghệ Sinh H c trƣờng Đại H c Nông Lâm Thành Phố H Chí Minh chấp thuận Viện Nghiên C u Nuôi Trồng Thuỷ ... tr c h a h c -1, 3 /1, 6-glucan H nh 2.5 C u tr c h a h c vitamin C 12 H nh 3 .1 Gây nhiễm WSSV cho tôm c ch tiêm 19 Sơ đồ 3 .1 Quy trình tổng quát chẩn đoán IHC 20 H nh 3.2 H nh...
- 63
- 547
- 0
Bài giảng Cac QD khen thuong h sinh ky 1
... Đ C LINH NGUYỄN MINH TÂM H THỊ THUỲ LINH VŨ THỊ QUÝ NGUYỄN ĐÌNH TÀI Lớp Môn 12 a2 12 a2 12 a2 12 a2 12 b 11 12a3 12 a2 12 a4 12 a2 12 b 11 12a4 12 b4 12 b 11 12a2 12 b2 12 a4 12 a3 12 b2 12 a4 12 b7 12 a2 Hoá h c ... DANH SÁCH H C SINH ĐẠT DANH HIỆU H C SINH GIỎI C P TỈNH ĐƯ C KHEN THƯỞNG Kèm QĐ số / QĐ-KT-2 011 -THPT QL1, ngày 06 tháng 01năm 2 011 TT 10 11 12 13 14 15 16 17 18 19 20 21 H tên Hoàng thÞ v©n ... ngày 18 tháng 01 năm 2 011 , - Theo đề nghị ông, bà giáo viên chủ nhiệm lớp QUYẾT ĐỊNH Điều 1/ C ng nhận 12 4 h c sinh đạt danh hiệu H c sinh Giỏi H c kỳ - Năm h c 2 010 - 2 011 , c nhiều thành tích...
- 5
- 275
- 0
Tài liệu Cac QD khen thuong h sinh ky 1
... Đ C LINH NGUYỄN MINH TÂM H THỊ THUỲ LINH VŨ THỊ QUÝ NGUYỄN ĐÌNH TÀI Lớp Môn 12 a2 12 a2 12 a2 12 a2 12 b 11 12a3 12 a2 12 a4 12 a2 12 b 11 12a4 12 b4 12 b 11 12a2 12 b2 12 a4 12 a3 12 b2 12 a4 12 b7 12 a2 Hoá h c ... DANH SÁCH H C SINH ĐẠT DANH HIỆU H C SINH GIỎI C P TỈNH ĐƯ C KHEN THƯỞNG Kèm QĐ số / QĐ-KT-2 011 -THPT QL1, ngày 06 tháng 01năm 2 011 TT 10 11 12 13 14 15 16 17 18 19 20 21 H tên Hoàng thÞ v©n ... ngày 18 tháng 01 năm 2 011 , - Theo đề nghị ông, bà giáo viên chủ nhiệm lớp QUYẾT ĐỊNH Điều 1/ C ng nhận 12 4 h c sinh đạt danh hiệu H c sinh Giỏi H c kỳ - Năm h c 2 010 - 2 011 , c nhiều thành tích...
- 5
- 273
- 0
Gián án Cac QD khen thuong h sinh ky 1
... Đ C LINH NGUYỄN MINH TÂM H THỊ THUỲ LINH VŨ THỊ QUÝ NGUYỄN ĐÌNH TÀI Lớp Môn 12 a2 12 a2 12 a2 12 a2 12 b 11 12a3 12 a2 12 a4 12 a2 12 b 11 12a4 12 b4 12 b 11 12a2 12 b2 12 a4 12 a3 12 b2 12 a4 12 b7 12 a2 Hoá h c ... DANH SÁCH H C SINH ĐẠT DANH HIỆU H C SINH GIỎI C P TỈNH ĐƯ C KHEN THƯỞNG Kèm QĐ số / QĐ-KT-2 011 -THPT QL1, ngày 06 tháng 01năm 2 011 TT 10 11 12 13 14 15 16 17 18 19 20 21 H tên Hoàng thÞ v©n ... ngày 18 tháng 01 năm 2 011 , - Theo đề nghị ông, bà giáo viên chủ nhiệm lớp QUYẾT ĐỊNH Điều 1/ C ng nhận 12 4 h c sinh đạt danh hiệu H c sinh Giỏi H c kỳ - Năm h c 2 010 - 2 011 , c nhiều thành tích...
- 5
- 267
- 0
Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx
... HO -1, which participates in a-mesospeci c heme decomposition, is not conserved (Leu in GmHO -1) [14 ] Thus, our first concern in examining plant HOs is to determine whether the plant HO lacking the ... rHO -1 in the presence of ascorbate (Table 4) This means that the first reduction of the ferric heme is harder to achieve in the GmHO -1 and SynHO -1 reactions than in the rHO -1 reaction (Scheme 1) , ... (1 lM) NADPH ⁄ FNR ⁄ Fd of GmHO -1 was also compared with that of SynHO -1 under similar conditions, as well as that of rHO -1 in the presence of NADPH ⁄ cytochrome P450 reductase (CPR; NADPH:cytochrome...
- 16
- 617
- 0
Tài liệu Báo cáo khoa học: Adaptive changes in the expression of nuclear and mitochondrial encoded subunits of cytochrome c oxidase and the catalytic activity during hypoxia pptx
... protein )1) Enzyme activity Isocitrate dehydrogenase (lmolÆmin )1 mg protein )1) Complex I (lmolÆmin )1 mg protein )1) Hexokinase (lmolÆmin )1 mg protein )1) Phosphofructokinase (lmolÆmin )1 mg protein )1) ... this time point, the CytOX activity (mol cytochrome c oxidizedÆmin )1 mg SMP )1) was reduced only marginally in PC12 cells but was decreased by 52% in macrophages (Table 1) With the accompanying ... enzyme content the TN of the CytOX complex for cytochrome c oxidation essentially remained unaltered in macrophages, while the TN was slightly enhanced in PC12 cells (Table 1) This is in sharp contrast...
- 9
- 554
- 0
Báo cáo khoa học: A mitochondrial cytochrome b mutation causing severe respiratory chain enzyme deficiency in humans and yeast doc
... 17 .0 a Cytochrome content in intact cells estimated from the dithionitereduced spectra b Calculated from the decylubiquinol cytochrome c reductase assay as described in [ 21] c Concentration in ... respiratory chain defect (Table 1) Fourth, the 15 699 G C mutation changes a positively charged amino acid (Arg 318 ) to a hydrophobic amino acid (proline) in a highly conserved region of the cytochrome ... documented in a patient with cardiomyopathy [10 ], affected the stability of the FEBS Journal 272 (2005) 3583–3592 ª 2005 FEBS Cytochrome content (nmolÆg )1) a Cytochrome b Cytochrome c Cytochrome...
- 10
- 317
- 0
Báo cáo khoa học: Essential roles of lipoyl domains in the activated function and control of pyruvate dehydrogenase kinases and phosphatase isoform 1 pot
... conformational change in the PDP 1c could create such a high-affinity Ca2+-binding site to stabilize the nascent interaction between the protein components Because the highly activating binding of PDP1 ... PDK1 binds to the L1 and L2 domains of E2 (Fig 1) PDK1 is particularly effective in phosphorylating the third phosphorylation site on E1 [30] The PDK2 [11 ] and branched chain dehydrogenase kinase ... Machius, M., Chaung, J.L., Wynn, R.M., Tomchick, D.R & Chuang, D.T (20 01) Structure of rat BCKD kinase: Nucleotideinduced domain communication in a mitochondrial protein kinase Proc Natl Acad Sci USA...
- 7
- 385
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25