multislice computed tomography of a repaired anomalous left coronary artery arising from the pulmonary artery tex heart inst j 2008 35 4 485 486
Báo cáo y học: "Chest computed tomography of a patient revealing severe hypoxia due to amniotic fluid embolism: a case repor" ppsx
... was obtained from the patient for the publication of this case report and any accompanying images A copy of the written consent is available for review by the Editor-in-Chief of this journal Abbreviations ... in a young primipara, delayed development of moderate respiratory symptoms followed by profound cardiorespiratory failure half day later, and a lack of signs of disseminated intravascular coagulation ... 172:1158-1169 Kramer MS, Rouleau J, Baskett TF, Joseph KS: Maternal Health Study Group of the Canadian Perinatal Surveillance System Amniotic fluid embolism and medical induction of labor: a retrospective,...
- 3
- 200
- 0
Báo cáo khoa học: Molecular cloning and functional expression of a gene encoding an antiarrhythmia peptide derived from the scorpion toxin pptx
... AaHIT4, the unique anti-insect toxin also has a toxic effect on mammals and can acts on the a- and b-sites of the mammalian sodium channel [44 ] Therefore, whether Tyr31 is related 44 74 F Peng et al ... with the guidelines laid down by the National Institutes of Health in the USA regarding the care and use of experimental animals and committee giving approval for the experiments The right jugular ... obtained was displayed an ORF of 258 bp encoding a polypeptide of 85 amino acids and termed BmKIM The 5¢ and 3¢ UTRs of BmKIM cDNA are 17 bp and 76 bp, respectively A single AATAAA polyadenylation...
- 8
- 473
- 0
Sea piracy and the formation of a regional response constructing asean maritime security from the strait of malacca anti piracy cooperation
... Littoral States (Variable X) ASEAN-wide* (Variable Y) ASEAN Declaration on Japan Coast Guards 1997 Transnational Crime Meeting of Specialist Officials on 1998 Maritime Issues ASEAN Plan of Action ... the littoral states of the Strait of Malacca, implemented an arsenal of anti-piracy mechanisms that effectively eradicated maritime piracy from the subregion The subregional cooperation was a ... deal with the threat to international shipping posed by piracy and armed robbery against ships In the Malacca Straits The issue of maritime piracy in the Strait of Malacca seems to have resurfaced...
- 129
- 531
- 0
Báo cáo y học: " Evolution of changes in the computed tomography scans of the brain of a patient with left middle cerebral artery infarction: a case report" pps
... density changes in appearance to become isodense with brain tissue and ultimately (after at least a month) to appear as an area of low density Figure admission Computed tomography scan of the brain ... appear normal and the low density area may not be apparent Some early signs of acute MCA infarction are loss of definition of the grey/white interface in the lateral margins of the insula, leading ... been no change to the probable longstanding calcification within the right basal ganglia Final diagnosis The appearances are those of extensive left MCA infarction [4] Although the first scan would...
- 4
- 508
- 0
báo cáo khoa học: "A role of 18F-fluorodeoxyglucose positron emission/computed tomography in a strategy for abdominal wall metastasis of colorectal mucinous adenocarcinoma developed after laparoscopic surgery" pptx
... revealed a small nodule in the abdominal wall, which was difficult to interpret as metastasis of cecal cancer by only computed tomography image Page of in the small abdominal nodule, but no further ... February 2009 The tumor was located in the abdominal wall, slightly exposed to the abdominal cavity There was no gross evidence of metastasis in the abdominal cavity and cytological examination ... size and diabetes Mucinous adenocarcinoma as a histological type, regardless of the organs, may result in more false negatives as well Sarikaya et al [21] reported that of patients (60%) with false-negative...
- 5
- 375
- 0
Báo cáo y học: "Multislice computed tomography is useful for evaluating partial anomalous pulmonary venous connectio" pdf
... Gustafson RA, Tarnay TJ, Neal WA: An alternative method for repair of partial anomalous pulmonary venous connection to the superior vena cava Ann Thorac Surg 19 84, 38(6):601-5 Nakahira A, Yagihara ... Aboal J: Multislice CT in congenital heart disease: Partial anomalous pulmonary venous connection Pediatr Cardiol 2008, 29(6):1120-1 doi: 10.1186/1 749 -8090-5 -40 Cite this article as: Kasahara ... D - A target component-enhanced image derived from MDCT The arrow indicates the anastomosis site of the left atrium appendage with the vertical vein The asterisk (green) indicates the left atrium...
- 3
- 256
- 0
báo cáo khoa học: "Anomalous origin of the left coronary artery from the pulmonary artery associated with an accessory atrioventricular pathway and managed successfully with surgical and interventional electrophysiological treatment: a case report" docx
... coronary artery from the pulmonary artery, and (B) location of the successful ablation site at the left posterolateral area Shown are the coronary sinus catheter (*) and the ablation catheter ... suspicion of probable ALCAPA was raised after his third echocardiographic examination and was confirmed by a CT scan The left coronary artery originated from the leftward-facing sinus of the pulmonary ... dysplasia There are two theories regarding the development of the ALCAPA anomaly: the older embryological theory of Abrikossoff abnormal septation of conotruncus into the aorta and pulmonary artery, ...
- 4
- 247
- 0
Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx
... Kuwada M, Teramoto T, Kumagaye KY, Nakajima K, Watanabe T, Kawai T, Kawakami Y, Niidome T, Sawada K, Nishizawa Y et al (19 94) Omega-agatoxinTK containing D-serine at position 46 , but not synthetic ... linkage by an enzyme from frog skin secretions Proc Natl Acad Sci USA 102, 4 235 42 39 Shikata Y, Watanabe T, Teramoto T, Inoue A, Kawakami Y, Nishizawa Y, Katayama K & Kuwada M (1995) Isolation and ... Shimonishi Y, Yasuda-Kamatani Y, Minakata H, Nomoto K, Muneoka Y & Kobayashi M (1991) Fulicin, a novel neuropeptide containing a D-amino acid residue isolated from the ganglia of Achatina fulica Biochem...
- 12
- 616
- 0
Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx
... immediately shifted from 40 5 to 41 5 nm, and at the same time, distinct absorption bands of oxyheme appeared at 540 and 579 nm Then, a broad band appeared at around 660 nm, and was maximal 9–12 after ... in Fig 5A, addition of ascorbate to the solution of heme–GmHO-1 initiates the reaction, as revealed by gradual diminution of the Soret band After several minutes, a broad band appears at around ... band so that it almost vanished after 30 min, and instead, an absorption peak appeared at 637 nm, suggesting the formation of CO–verdoheme The 637 nm band disappeared gradually and was replaced...
- 16
- 617
- 0
Tài liệu Báo cáo khoa học: Characterization of a recombinantly expressed proteinase K-like enzyme from a psychrotrophic Serratia sp. ppt
... ng of genomic DNA as template, 0.2 mm dATP, dCTP, dGTP and dTTP, 0.2 lm of upstream primer (OP17: 5¢-GA AAAACCATGGTGAATGAATACCAAGCGACT-3¢) and downstream primer (NP7: 5¢-CAATCTCCATGGCTAG TAGCTTGCACTCAG-3¢) ... CA-3¢ along with the adaptor primers: AP1 (5¢-GTAATAC GACTCACTATAGGGC-3¢) and AP2 (5¢-ACTATAGGG CACGCGTGGT-3¢) Nested PCR was carried out in a final volume of 50 lL containing lL of a genome walking ... 5¢-GATGAAAATCCTAACCTCTCCCCCGCACAG3¢; OP7, 5¢-ACTGCACCTACGGCGGGTCGTTGGTACG TG-3¢; NP4, 5¢-GACACCGTAGGTTGAGCCGCCAATC GTCCC-3¢; NP5, 5¢-CTTTAACTTGTTGGGCACTGG CATTG-3¢; NP6, 5¢-TTGATCGATTCTGTCTATGCCC...
- 14
- 523
- 0
Campaigns of a Non-Combatant, and His Romaunt Abroad During the War ppt
... the astonished Federals, and they raised the national flag within the fortifications, in the gray of the morning of the 4th of May Many negroes also escaped the vigilance of their taskmasters, and ... Vliet, Quartermaster-General And the man at the table, was General Marcy, father-in-law to McClellan, and Executive officer of the army Maps, papers, books, and luggage lay around the room; all the ... remnant of the African and the American were to look from their Island Home upon the clash of our armies and the murder of our braves CHAPTER VIII 37 By the 19th of May the skirts of the grand army...
- 175
- 443
- 0
Báo cáo khoa học: Crystal structure and enzymatic properties of a bacterial family 19 chitinase reveal differences from plant enzymes pdf
... bacterial family 19 chitinases have catalytic domains that are at least as large as those of the plant enzymes and that may contain at least six subsites [26,30] However, the catalytic 48 94 domains ... ¼ 48 .67 A, b ¼ 74. 38 A, c ¼ 64. 18 A and ˚ resolution b ¼ 108.6°, and diffracted to at least 1.5 A Crystal data and data collection statistics are summarized in Table Calculation of the Matthews ... Homer RJ, Kim YK, Chen NY, Cohn L, Hamid Q & Elias JA (20 04) Acidic mammalian chitinase in asthmatic Th2 inflammation and IL-13 pathway activation Science 3 04, 1678– 1682 Kasprzewska A (2003) Plant...
- 12
- 399
- 0
Báo cáo khoa học: Characterization of a novel long-chain acyl-CoA thioesterase from Alcaligenes faecalis docx
... MO, USA Bacterial strain The strain isolated from soil samples was identified as a bacterium, A faecalis according to Bergey’s Manual [31], and was designated A faecalis ISH108 The strain has been ... 8.67 – – 2380 acetate propanoate butanoate hexanoate dodecanoate palmitate stearate FEBS Journal 273 (2006) 23 74 2387 ª 2006 IMTECH P Shahi et al Thioesterase of Alcaligenes faecalis Reagent (1 mM) ... prevent the abnormal accumulation of intracellular acyl-CoA We have isolated a thioesterase from Alcaligenes faecalis ISH108 and demonstrated its application in FEBS Journal 273 (2006) 23 74 2387...
- 14
- 513
- 0
Báo cáo khoa học: Characterization of a second proliferating cell nuclear antigen (PCNA2) from Drosophila melanogaster docx
... reagents (Amersham Pharmacia Biotech, Piscataway, NJ) Animals were fed water and standard rabbit food and maintained on a 12 h light/dark cycle Polyclonal antiserum to the peptide was raised in rabbits ... and had a Drosophila consensus sequence for translation initiation, 5¢-(C ⁄ A) AA (A ⁄ C)ATG, and a putative poly (A) addition signal sequence, 5¢-AATAAA [17,18] It encoded a predicted product of ... Synthesis System (Invitrogen, Carlsbad, CA) with an oligo-(dT)12)18 primer Amplification of the DmPCNA2 cDNA was performed using ExTaq thermostable DNA polymerase (TaKaRa, Ohtsu, Japan) and the...
- 12
- 404
- 0
Báo cáo khoa học: Characterization of a hemocyte intracellular fatty acid-binding protein from crayfish (Pacifastacus leniusculus) and shrimp (Penaeus monodon) pdf
... (Qiagen) Primers (45 8+ GGCAGCAGCAGTGACAGT AGCAATAG and 596– ACGAGGAAGCGAAGGATGA TGATGG) were chosen to amplify a 139-base pair fragment of the plFABP Primers specific to the crayfish ribosomal 40 S ... membrane The membranes were then subjected to image plates for the phosphoimager BAS-2 040 (Fuji, Tokyo, Japan) The radioactivity was quantified using the image gauge program, version 3 .4 (Fuji) Crayfish ... (156+ GACGAATGGCATACACCTGAG AGG and 280– CAGGACTCTGCAGTTCAAGCTGATG) were used to quantify cellular RNA input of each preparation with a 125-bp PCR product The PCR mixture contained 12.5 lL · QuantiTecttm...
- 11
- 545
- 0
Báo cáo khoa học: Functional dissection of a small anaerobically induced bZIP transcription factor from tomato pdf
... TACTCGAGATGTCACCTTTAAGGCAGAG-3¢ and 5¢-ATATCCATGGAAAATTTAAACAATCCTGATG-3¢ Abz1(1 44 ): 5¢-TATACTCGAGATGTCACCTTTAAG GCAGAG-3¢ and 5¢-ATATCCATGGGCTTCTTCATC CTCGATCGC-3¢ Abz1(1– 24) : 5¢-TATACTCGAGAT ... 5¢-TATACTCGAGAT GTCACCTTTAAGGCAGAG-3¢ and 5¢-ATATCCATG GTCTCATCCATTCCTGCATAC-3¢ Abz1 (45 –138): 5¢TATACTCGAGATGCAGAAGCTTCTGCAAGATTT GAC-3¢ and 5¢-ATATCCATGGAAAATTTAAACAA TCCTGATG-3¢ The XhoI and NcoI sites ... N-terminal deletion, ABZ1 (47 –138): 5¢-TATGGATCCATGC TTCTGCAAGATTTGACAGG-3¢ and 5¢-ATATCCC GGGTTAAAATTTAAACAATCCTG-3¢ C-terminal deletion, ABZ1(1–100): 5¢-TATAGGATCCATGTCACC TTTAAGGCAGAG-3¢ and 5¢-ATACCCGGGTTATAA...
- 11
- 536
- 0
Báo cáo Y học: Purification and catalytic properties of a CO-oxidizing:H2-evolving enzyme complex from Carboxydothermus hydrogenoformans doc
... in the SDS-polyacrylamide gels of nonboiled protein samples The deviation of the apparent molecular mass of the dimer from the calculated value of 1 24 kDa may be related to the fact that the ... Biosystems) The accuracy of external calibration was, in general, better than 0.02% Amino acid sequence analysis Preliminary sequence data of the C hydrogenoformans genome was obtained from The Institute ... indicated, the enzyme was activated with mM Ti(III)citrate prior to the assay and mM Ti(III)citrate was added to the assay mixture The gas phase was 100% CO (1 · 105 Pa) or as indicated The reaction...
- 10
- 376
- 0
Báo cáo Y học: Structural and functional characterization of a C-type lectin-like antifreeze protein from rainbow smelt (Osmerus mordax) potx
... be the case This may be relevant to the calculation of smelt AFP activity The activity of smelt AFP is about one-third of that of sea raven AFP on a monomer concentration basis [11] As sea raven ... EDTA instead of CaCl2 In the absence of added Ca2+, dimerization was again observed (Fig 5C) The molecular mass of smelt AFP determined by HPLC gel-filtration analysis was 50 kDa (Fig 6) As the ... migrate faster than its actual mass would predict because of limited linearization in SDS The value of 38 kDa is consistent with such a dimer band A small amount of a high-molecular-mass aggregate...
- 8
- 518
- 0
The preference of a Female Greek island population in regard to the gender of their gynecologist pdf
... and contingency tables were formed on the questioned variables The x2 test was used on the qualitative variables and the t-test on the quantitative variables From the total of the examined variables, ... took part in the study The average age of the women of the sample was 43 ±11.02 years old, with 18 years being the minimum and 71 the maximum age Eighty seven percent (1 74) of the women were married, ... with an average age of 42 ±10.52 years (Table 1) The average age of the single women was 34 12.01 years A 55.5% had 1-2 children A 79.5% (159) of the women were working , while 87.1% of the women...
- 9
- 432
- 0
Báo cáo khoa học: Characterization of the role of a trimeric protein phosphatase complex in recovery from cisplatin-induced versus noncrosslinking DNA damage potx
... this is the case, removal from the action of the ataxia telangiectasia mutated (ATM) ⁄ ataxia telangiectasia and RAD53 related (ATR) kinases at the site of DNA damage may decrease the kinase ⁄ ... psy4D::kanMX4 BY4 743 psy2D::kanMX4 ⁄ psy2D::kanMX4 BY4 743 pph21D::kanMX4 ⁄ pph21D::kanMX4 Euroscarf Euroscarf Euroscarf Euroscarf Euroscarf Euroscarf Euroscarf Euroscarf Euroscarf to FACS analysis ... BY4 741 psy4D::kanMX4 BY4 741 psy2D::kanMX4 MATa ⁄ MATa; his3D1 ⁄ his3D1; leu2D0 ⁄ leu2D0; met15D0 ⁄ MET15; LYS2 ⁄ lys2D0; ura3D0 ⁄ ura3D0 BY4 743 pph3D::kanMX4 ⁄ pph3D::kanMX4 BY4 743 psy4D::kanMX4...
- 11
- 362
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008