... generation ofcells with properties of stem cells, and to the ability oftumorcells to enter the circulation and seed metastases EpCAM-CK double positive CTC might represent only a subpopulation of ... combination of the both methods, in comparison to sole CD45 depletion However, the purity remained in the order of 1% with all three methods To evaluate the specificity of the methods presence of EpCAM+CK+CD45-, ... EpCAM+CK- cells (0/15), whereas we observed presence of EpCAM-CK+ cells in sample (1/15 = 7%) Flow Cytometry Linearity ofCTC enrichment by CD45 depletion After enrichment for CTCs, cells were...
... generation ofcells with properties of stem cells, and to the ability oftumorcells to enter the circulation and seed metastases EpCAM-CK double positive CTC might represent only a subpopulation of ... combination of the both methods, in comparison to sole CD45 depletion However, the purity remained in the order of 1% with all three methods To evaluate the specificity of the methods presence of EpCAM+CK+CD45-, ... EpCAM+CK- cells (0/15), whereas we observed presence of EpCAM-CK+ cells in sample (1/15 = 7%) Flow Cytometry Linearity ofCTC enrichment by CD45 depletion After enrichment for CTCs, cells were...
... of Hematology & Oncology 2008, 1:2 http://www.jhoonline.org/content/1/1/2 Background Materials and methods The presence ofcirculatingtumorcells (CTC) in peripheral blood and disseminated tumor ... More effort should be invested in optimizing these methods List of abbreviations CTC: Circulatingtumor cells; PBMC: Peripheral blood mononuclear cells; CK19: Cytokeratin; B2M: Beta microglobulin; ... Understanding the biology of the background expression oftumor markers will be instrumental in development of more specific methods to detect CTC Isolation of PBMC from Whole Blood Blood was collected...
... subpopulations of immune cellsof the adaptive and innate immune system It activates effector T cells; induces IFN-γ, TNF-α, IL-1α, and GM-CSF production; promotes Th1 differentiation of naive T cells; ... Institutional Review Board of the University of Pennsylvania Tumor inoculation For intraperitoneal (i.p.) tumors, ID8-Vegf cells were injected at × 106 per mouse For subcutaneous (s.c.) tumors, a single ... sensitize tumor to immune effector cells [18] To assess the capacity of Doxil to sensitize ovarian cancer cells to immune attack, we identified doses of Doxil in vitro at which greater than 50% of ID8...
... lower numbers ofcells after 14 days of culture (data not shown) The number ofcirculating CD14+ cells was reduced in SLE patients, although less pronounced than the number ofcirculating CD34– ... hematopoietic progenitor cells, but not on mature endothelial cells [19,21] During maturation of these cells, the expression of CD133 is lost The combined expression of CD34 and CD133, therefore, ... and CD133, therefore, defines a population of (immature) circulating progenitor cells Because of the low number of CD34 and CD133 (double-)positive cells in the peripheral blood, we chose to...
... nature of this regulation has prevented elucidation of the underlying mechanisms of circadian changes in circulating blood cells [2] The present study found that a homozygous mutation of the ... peripheral circulating redblood cells CircadianClock mutant mice Circadian variations in peripheral circulating redblood cells (RBC) in Clock mutant mice (A) Number of RBC and (B) blood levels of hemoglobin ... Circadian variations in peripheral circulatingleukocytes in Clock mutant mice (A) Total number of white blood cells (WBC), (B) number of lymphocytes, (C) number of neutrophils Open and filled circles,...
... Primer name GenBank Accession Number Sequence 5' – 3' ELF3 s AF016295 CTCGGAGCTCCCACTCCTCAGA ELF3 as EPHB4 s GCTCTTCTTGCCCTCGAGACAGT AB209644 EPHB4 as EGFR s AB209442 TACSTD1 as MGB1 s MGB1 as ... by RT-PCR for the panel of markers Seeding dilutions of MDAMB453 into normal blood resulted in consistent detection of all RT-PCR markers at a level of 10 cells per ml of blood (Figure 1) In samples ... per ml of blood (10 cells total), marker expression was detected in 2/3 samples indicating some loss ofcells during the immunobead isolation In the main part of this study, the expression of the...
... normal cells as well as in tumorcells However, in tumorcells the importance of the objectives and thus their relative share in total glucose utilization varies during different stages oftumor ... regulation of this enzyme in tumorcells According to a proteome analysis of human liver tumor tissue there is no evidence for a significant tumor- related change of the protein level of this enzyme ... capable of reducing the level of fructose 2,6-P2 independent of the phosphorylation state of iPFK-2 Reducing the level of fructose 2,6-P2 and thus the activity of PFK-1 improves the supply of glucose...
... differentiated cells tested so far have been resistant to HAMLET’s lethal effects In tumor cells, HAMLET enters the cytoplasm oftumorcells and accumulates in the nuclei [2,30,41,42] Healthy cells, ... kill tumorcells regardless of their Bcl-2 and p53 status [50] This is consistent with apoptosis being a cellular response, but not the cause of death HAMLET-treated tumorcells also show signs of ... shedding of dead tumor cells, as determined by Trypan blue exclusion and the cells showed signs of apoptosis (Fig 3) At surgery, a reduction in tumor size was observed in six patients and four of the...
... proliferation rate of LNCaP cells First, we studied whether overexpression or downregulation of TPD52 influences the proliferation rate of LNCaP cells To determine the effect of TPD52 expression ... downregulation of TPD52 in LNCaP cells MTT assays showed a significantly increased proliferation of the PCA cell line LNCaP after transient overexpression of EGFPTPD52 (Fig 3A) The proliferation of these cells ... LNCaP cells (Fig 4G) In 30% of the TPD52 knockdown cells, a significant decrease of Dwm (P £ 0.0013) could be observed, whereas nontransfected or mock transfected cells were less than 10% of the...
... 1985 ´ndez et al ´ A Marın-Herna Control of glycolysis in tumorcells Cell extracts oftumor and liver cells )1 Determination of flux control coefficients Cells (65 mg proteinÆmL ) were resuspended ... 2006 FEBS ´ ´ A Marın-Hernandez et al Control of glycolysis in tumorcells Table Maximal activity of glycolytic enzymes in hepatocytes and tumorcells AS-30D, HeLa and hepatocytes (65 mg proteinÆmL)1) ... both tumor cell types, being negligible in AS-30D cells The difference between the rates of lactate formation with and withTable Glycolysis in hepatocytes and tumorcells AS-30D and HeLa cells...
... ofcells counted cells being 30,000 per sample The percentage of CD133 and CD34 positive cells was calculated based on the measured number of leukocytes (CD45-positive cells) Quantification of ... Chandler AZ), was capable of increasing the number ofcirculating stem cells and progenitor cells This proprietary food supplement is produced by fermentation of a combination of green tea, astralagus, ... circumscribed by spindle shaped cells and were counted by microscope As the number of colonies depends on the number of plated cells, normalization of colony number based amount ofcells plated was performed...
... unique profile of factors secreted by the tumor [16,17,20] Preclinical models of human tumor- induced MDSC will significantly advance knowledge of their induction and function as suppressor cells ... subsets of MDSC have been identified that will help elucidate the role of these cells in the ontogeny, spread, and treatment of cancer Page of 20 Methods Cell Lines and Cell Culture Tumor cell ... function of tumor- educated myeloid cells was measured by their ability to inhibit the proliferation of autologous T cells in the following Suppression Assay: T cells isolated from 30 mL of PBMC...
... presence oftumorcellscirculating in peripheral blood of gynecological cancer patients Thus, the expression of CGB and GNRH1 may become a prognostic factor of metastatic spread oftumorcells ... specificity of the genes activity as an informative way to identify tumorcellsof gynecological origin in blood of cancer patients, which can indicate metastatic spread oftumorcells These ... role ofcirculatingtumorcells in metastatic spread of carcinomas has already been very well documented However the biology of these cells is poorly understood and the clinical relevance of their...
... Enhanced expression of Brn-3a(l) in stromal cellsof high grade tumors may contribute to the metastatic ability of tumors cells as demonstrated by the tumor growth enhancing effects of cancer associated ... and perfectly round cells Fibroblasts were long elongated cells whereas tumorcells were large with visible nuclei In many cases, large multinucleated tumorcells were visible Tumor cell cultures ... lines as well as tumorcells isolated from ascites of advancedstage cancer patients Immunofluorescence analyses Immunofluorescence study was performed to determine the differences of Brn-3a expression...
... distribution of the frequencies of CD4+CD28– T cells (Fig 1b) The cutoff value determined at the intersection of the two bimodal distribution curves was 1.7% Using this cutoff value, 70.3% of the AS ... transformation of percentages of CD3+CD4+CD28– T cells was performed to detect different populations of CD4+ T cells and to correct for data skewing We found a bimodal distribution of frequencies of CD3+CD4+CD28– ... specificity Levels of CD3+CD4+CD28– T cells in patients with ankylosing spondylitis and healthy control individuals (a) Accumulation of CD3+CD4+CD28– cells in peripheral blood mononuclear cellsof 95 patients...
... resection of the tumor Partial skin necrosis occurred postoperatively at the insertion site of one of the pins In Case 8, the Page of skin became partially necrotic at the frontal aspect of the ... the invasion oftumorcells up to the epiphyseal plate in 21 of the 25 patients [33-37] When minimal surgery is performed, the surgical procedure must be designed carefully Methodsof assessing ... selection of reconstruction methods similar to those for Type II, and new diagnostic imaging techniques for the evaluation of the effects of such methods Additional material Additional file Details of...
... origin of these cells (Figure 2a– c) Moreover, complementary staining with MPO, CD20, CD3, CD45 and smooth muscle actin excluded the possibility of contamination with myeloid cells, B cells, T cells ... with RA [45] Our results agree with findings of the absence of a major role of TNF-α in the pathogenesis of pSS, as illustrated by the lack of efficacy of TNF-α blockers in this disease [48] However, ... capacity of SGECs to express and secrete BAFF after stimulation by IFN This peculiar property of epithelial cells is enhanced in patients with pSS and confirms the importance of resident cellsof target...
... concentrations of doxorubicin, the numbers of viable Figure Characterization of doxorubicin treatment oftumorcells MOSEC or MOSEC/luc tumorcells (1 × 106) were cultured in the presence of different ... incubation of MOSEC cells with doxorubicin led to the intracellular uptake of the drug and the eventual death of the tumorcells We also found that drugloaded tumorcells were capable of transferring ... translocation of calreticulin (CRT) to the cell surface and result in improved processing oftumorcells by dendritic cells [23] Thus, the expression of CRT on the surface oftumorcells mediated...