mail as a customer service tool

Báo cáo khoa học: Mechanisms of amyloid ﬁbril self-assembly and inhibition Model short peptides as a key research tool pptx

... similar to aromatic DNA-intercalating agents Although DNA is the most important biological assembly stabilized by aromatic interactions [56], a diverse group of planar aromatic compounds can intercalate ... information of the role of aromatic moieties in amyloid ﬁbril formation [36–41] A parameter-free model based on the mathematical analysis of many peptide fragments and their analogues had clearly ... formation E Gazit case a central aromatic region was identiﬁed by the nonbiased peptide scan [22] Interestingly, the same motif was independently identiﬁed when analyzing peptide fragments [49] As...

8
440
0

assessing a customer service model in the financial services industry

Danh mục: Kinh tế

... vs Account Control Tech (as cited in “ACA International’s Guide,” 200 5a) , a collection agency repeatedly contacted a customer after it was warned that the customer had retained an attorney; and ... initiative program and assessed how employees and management applied the program in their ordinary workday The results will assist XYZ Financial Services and the financial services industry as a ... (DiTomaso & Hooijberg, 1996) Prilleltensky asserted, “For as long as personal interests are not threatened, and vision and values are clear, individuals are likely to engage in value-based actions”...

241
569
0

báo cáo khoa học: " Using the theory of planned behaviour as a process evaluation tool in randomised trials of knowledge translation strategies: A case study from UK primary care" pot

Danh mục: Báo cáo khoa học

... intention and behaviour, because the behaviour data were at a practice level, a summary measure of intention for each practice had to be calculated This was generated in two ways – by taking the mean ... Government Health Directorate Ruth Thomas was funded by the Wellcome Trust (GR0673790AIA) Bernard Croal was supported by a grant from Grampian Endowments Jeremy Grimshaw holds a Canada Research Chair ... information system This data are routinely collected and ascribed to the primary care practice and could not accurately be attributed to individual primary care doctors Statistical analysis In all...

9
367
0

báo cáo khoa học: " Mapping as a knowledge translation tool for Ontario Early Years Centres: views from data analysts and managers" pot

Danh mục: Báo cáo khoa học

... participated (representing eight teams; two of the eight teams have two data analysts and one manager, and the other six teams have one data analyst and one manager) Initially, twelve OEYC data analyst/manager ... analyst/manager dyads were asked to participate and four declined The reasons given for declining included vacancies in the data analyst position, and already having access to a commercial GIS tool Data ... data and then produce maps The participant explained: 'I thought that's what this was for, was to build capacity with a small little agency to be able to upload their own participation data and...

9
339
0

báo cáo khoa học: " Mapping as a knowledge translation tool for Ontario Early Years Centres: views from data analysts and managers" pps

Danh mục: Báo cáo khoa học

... participated (representing eight teams; two of the eight teams have two data analysts and one manager, and the other six teams have one data analyst and one manager) Initially, twelve OEYC data analyst/manager ... analyst/manager dyads were asked to participate and four declined The reasons given for declining included vacancies in the data analyst position, and already having access to a commercial GIS tool Data ... data and then produce maps The participant explained: 'I thought that's what this was for, was to build capacity with a small little agency to be able to upload their own participation data and...

9
318
0

Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly

Danh mục: Nông nghiệp

... pleasantness ratings, the aroma concentration had a similar effect on both age groups in the ﬁrst tasting session: the heightened aroma sample was rated as less pleasant than the regular aroma sample ... samples was created by a laboratory panel (n ¼ 9; females, males, aged 25 –41 years) trained to evaluate attributes selected in advance The attributes were evaluated on a 9-point scale that was ... signiﬁcant interaction of day and aroma on the pleasantness ratings of the young, implicating an increase in pleasantness of the heightened aroma sample in the presence of health-related information...

10
599
1

Configuring Ubuntu Server As a Mail Server

Danh mục: Quản trị mạng

... SERVER AS A MAIL SERVER administrator to manage all individual programs that comprise the Postfix mail server The disadvantage is that, as an administrator, you need to know how all these separate ... to your mailbox Summary This chapter explained the basics of how to set up Ubuntu Server as a mail server You learned how to configure Postfix as an easy-to-maintain MTA that exchanges mail with ... first column) and an action for each mail address (in the second column) You can specify the e -mail addresses as patterns You can refer to an actual e -mail address ( ), but you also can refer to...

32
380
0

Tài liệu Speaking as a Marketing Tool ppt

Danh mục: Kỹ năng nói tiếng Anh

... Plan Marketing - www.actionplan.com Speaking as a Marketing Tool 11 Robert Middleton Interviews Vickie Sullivan speaking as a marketing tool can really create some wonderful and qualified leads ... you, that’s a clue That’s a clue that they are not taking this seriously, that they are not going to help you and you can always back out You can always say, “I am so thrilled that you are pleased ... death because when you say speaker that has such a connotation that they start turning you off You don’t say, “I’m an author, I’m a speaker, I’m a business coach,” you say, “I am a strategic advisor...

40
327
0

Tài liệu Using a Web Service as a Data Source pdf

Danh mục: Kỹ thuật lập trình

... "Order_OrderDetails_Relation"; // [WebMethod] public DataSet LoadOrders( ) { DataSet ds = new DataSet( ); SqlDataAdapter da; // Fill the Order table and add it to the DataSet da = new SqlDataAdapter("SELECT ... OrderDetails table and add it to the DataSet da = new SqlDataAdapter("SELECT * FROM [Order Details]", ConfigurationSettings.AppSettings["DataConnectString"]); DataTable orderDetailTable = new DataTable(ORDERDETAILS_TABLE); ... between implementing the LoadOrders( )methods to retrieve a DataSet containing the Orders and Order Details data from Northwind as a local class or as a web services class [ Team LiB ] ...

4
369
0

Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx

Danh mục: Báo cáo khoa học

... Remarkably, we have found that, at least in some circumstances, a quantitative correlation to biophysical data can be obtained from a statistical analysis of selected phage populations [16] We also ... association of the variable heavy chain (VH) with protein A was used as a surrogate for direct stability measurements The VH domains in camelid heavy chain antibodies are most similar to the classical ... denaturant as a selective pressure to The potential for obtaining quantitative biophysical information from phage-display was suggested by a new method called alanine shotgun scanning, which analyzes...

7
502
0

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Danh mục: Báo cáo khoa học

... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG ... AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were ampliﬁed The PCR products ... rate to CPK % Product formation changed signiﬁcantly as the PK activity was modulated At increased PK activity we found an almost proportional increase in formate and acetate production and a...

12
616
0

Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc

Danh mục: Báo cáo khoa học

... cell spectrum and spectral areas selected by genetic algorithm A smear of about · 105 cells was dried on an area of cm2 on the germanium surface as explained in Materials and methods Wavenumbers ... ﬁnal model Linear discriminant analysis (LDA) This statistical multivariate method is supervised It searches for the variables containing the greatest interclass variance and the smallest intraclass ... et al assigned the shoulders present at 1117 and 1020 cm)1 to RNA and DNA, respectively [18] Classiﬁcation by LDA Classiﬁcation by LDA on spectra reduced by PCA PCA was performed on the training...

6
555
0

Tài liệu Telephone (or E-mail) Customer Service doc

Danh mục: Quản trị kinh doanh

... repair it *A little note about hold Many companies eschew hold Don’t It can help as long as you are careful with it Hold is a great tool for the angry customer It can help an irate customer calm ... flexible and gave him a lot, but not nearly as much as he asked for You have a happy customer, and the business will likely be yours for a very long time Lack of Empathy I recently had a customer ... than two or three minutes without updating them • Don’t put your angry customer on hold mid-rant • Always ask if it’s okay, make sure you have a callback number in case, as often happens, the customer...

7
385
0

Relational Cloud: A Database-as-a-Service for the Cloud potx

Danh mục: Cơ sở dữ liệu

... A A Soror, U F Minhas, A Aboulnaga, K Salem, P Kokosielis, and S Kamath Automatic virtual machine conﬁguration for database workloads ACM Trans Database Syst., 35(1), 2010 [17] G Soundararajan, ... from the graph occasional statements that scan large portions of the database and (2) sampling tuples and transactions In Relational Cloud, a new database and workload are placed arbitrarily on ... multiple partitions when the load on a database exceeds the capacity of a sin- DATABASE PARTITIONING Relational Cloud uses database partitioning for two purposes: (1) to scale a single database to...

6
568
0

microsimulation as a tool for the evaluation of public policies potx

Danh mục: Quản trị mạng

...

359
408
0

Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc

Danh mục: Báo cáo khoa học

... those measures that are being used in the target areas as well as foreign countries, such as Indonesia, China, Bangladesh, Germany, Mexico, Colombia, USA. Some of them are introduced as follows. ... Table 7. Standardized score for costs of combinations Measure A1 +A2 .3 A1 +B1 A1 +B2 A1 +B1+B2 A2 .1 +A2 .3 A2 .1+B1 A2 .2 +A2 .3 A2 .2+B1 A2 .3+B1 A2 .3+B1+B2 Standardized cost Standardized score ... doing so, the consensus on the problems and their solutions can be reached. However, it is noted that MCA is subjective in its nature. In case the quantitative data are available, quantitative analysis (i.e. numerical ...

13
487
0

Community-Based Social Marketing as a Planning Tool - Community and Regional Planning Masters Project pptx

Danh mục: Tiếp thị - Bán hàng

... students, and community associations The program worked by offering discounted bus passes to individuals who purchased passes as part of a larger group-purchasing program The discount pass acted as an ... Community-Based Social Marketing as a Planning Tool local, state, and federal government agencies” (Global Action Plan) The U.S program is part of a larger international effort that is operating in ... 18.4% Strangers Other Page 32 5.3% 7.9% September/2002 Community-Based Social Marketing as a Planning Tool Community-Based Social Marketing as a Planning Tool September/2002 Page 33 Chapter Case Studies...

70
425
0

Surviving Customer Service A Frontline Employee Field Guide potx

Danh mục: Quản trị kinh doanh

... conversation At the publishing company I had a call come in late on a Friday afternoon Any call that came in late on a Friday was going to be a user of our assistive technology that was a guarantee ... I am prone to using any surface as a table Art and color escape me completely You may have a knack for organizing a space and making a room “warm” You may have a talent for replicating the master ... rollercoaster ride If a customer is looking for an answer they want an answer They want at the very least want a path to the answer If you sound like you are always asking a question, “I can that?”...

45
384
0

Giving as a Strategic Tool: Short guide

Danh mục: Tiếp thị - Bán hàng

... WWW.STRATEGY of G I V I N G C O M Giving initiates a movement.  A company that has  generated movement  in the recipients can then  direct this energy SoG WWW.STRATEGY of G I V I N G C O M A company that gives ... most visible. At the same  time, it is the hardest WWW.STRATEGY of G I V I N G C O M Giving process is  only actualized  when the receiver  accepts it WWW.STRATEGY of G I V I N G C O M Receiving a gift always  ... SoG WWW.STRATEGY of G I V I N G C O M How can this be  turned into  a strategy? SoG WWW.STRATEGY of G I V I N G C O M Think backwards WWW.STRATEGY of G I V I N G C O M WWW.STRATEGY of G I...

27
335
0

báo cáo hóa học: " Cultural adaptation into Spanish of the generalized anxiety disorder-7 (GAD-7) scale as a screening tool" pot

Danh mục: Hóa học - Dầu khí

... Hospital Anxiety and Depression Scale (HADS, anxiety domain), and the WHO-DAS II disability questionnaire was calculated Concordance between classification criteria was assessed by inter-rater agreement ... Vindel A: Trastornos de ansiedad, Sociedad Española para el estudio de la Ansiedad y el Estrés (SEAS) 2005http://www.ucm.es/info/ seas/ta/index.htm, (last update: March 7th, 2005; last accessed: ... and to assess the efficacy of psychosocial and psychopharmacological interventions in these patients Many health questionnaire-based instruments allowing clinicians to approach GAD at any healthcare...

11
537
0