line such as for better impedance match the structure of phase shifter was designed by a high performance full wave electromagnetic field simulator hfss the primary parameters used to simulate
Tunable ferroelectric thin film devices for microwave applications
... (b) The side view of a parallel plate varactor (c) The photograph of top view of a varactor 82 Figure 4.3 The matching impedance of phase shifter circuit as a function of capacitance of shunt varactor ... microwave phase shift properties Then, an analog microwave phase shifter, which consists of coupled microstrip line loaded with parallel plate BST varactors and two planar Marchand baluns, was ... parallel-plate varactors and its applications in tunable devices; to integrate the parallelplate varactors into tunable microwave devices such as tunable matching network, tunable filter and phase shifter...
- 150
- 478
- 0
Vector sum phase shifter using a quadrature magic t for application in polarization control
... Polarization of antenna The EM wave used for either communication or radar is transmitted through an antenna The polarization of the EM wave is dependent on the polarization of the antenna Antenna ... HFSS was used for the detailed design A prototype was fabricated and tested Comparison of the measured results with the simulated results was performed to validate the design In Chapter 4, the ... decreased The phase difference between the output signals can also be decreased by increasing the amplitude of the signal to the sumport Therefore, a smaller signal to the delta port and a larger...
- 144
- 238
- 0
Tài liệu Category 6 and 5e Dynamic Angle Right/Left Patch Panels pptx
... notice At any time, you may verify product specifications by contacting our headquarters office in Minneapolis ADC Telecommunications, Inc views its patent portfolio as an important corporate asset ... = Orange Spec Sheet Specifications Performance: Applications Supported: Front Interface: Rear Interface: Weight: Rack Mounting: Safety: Operating Temperature: Storage Temperature: EIA/TIA 568-B ... Specifications published here are current as of the date of publication of this document Because we are continuously improving our products, ADC reserves the right to change specifications without...
- 2
- 288
- 0
Tài liệu Báo cáo khoa học: The Alzheimer b-peptide shows temperature-dependent transitions between left-handed 31-helix, b-strand and random coil secondary structures doc
... rotation was free and for dened structures the rotation was constrained The simulation was performed using a hard sphere model with a 1.3 A van der Waals radius of the heavy atoms Fifteen hundred structures ... 180) and with the same exibility The hydrodynamic radius was calculated as the radius of gyration, the mean distance from the centre of mass Acknowledgements This study was supported by a grant ... shorter fragments, Ab(19) and Ab(1228) at varying temperatures at 500 lm concentration and pH Assignment was based on standard procedures The aim was to obtain information on the temperature dependence...
- 12
- 287
- 0
transmission line matrix (tlm) in computational mechanics - d. de cogan, et al., (crc, 2006) ww
... is called the capacitance and has units (Farads) One of the simplest geometries is an arrangement of two parallel plates of area (A) , separated by a distance (L) in vacuum The capacitance is then ... (Maxwell’s Equations) The behavior of these impulses can be related to the propagation of electromagnetic waves and an analysis leads to a wave equation Different network formulations lead to ... scheme for the standard wave equation as a “perturbation,” positive or negative, half of which is added to the leftward-going wave and half to the rightward-going wave Cross derivative terms can also...
- 275
- 514
- 0
Báo cáo hóa học: " Efficient implementation of 90° phase shifter in FPGA" pptx
... gate) 7 Adder/subtractor 24 Page of converter The phase shifts obtained are 90.7°, 89.98°, and 89.73°, respectively The data from FPGA are captured in the PC and visualized in MATLAB The phase ... one as shown in Figure The setting of the carry in the tap adder eliminates the need for seven additional adders that are needed to implement the negative coefficients One adder is saved for each ... Naghmash, MF Ain, CY Hui, FPGA implementation of software defined radio model based 16QAM Eur J Sci Res 35(2), 301 (2009) H Shekhar, CB Mahto, N Vasudevan, FPGA implementation of tunable FFT for...
- 5
- 303
- 0
Báo cáo nghiên cứu khoa học: " FAST CALCULATING FORMULAS OF CURRENT PASSING THROUGH GROUNDING SYSTEM OF HIGH VOLTAGE SUBSTATION WHEN LIGHTNING STRIKES AT THE GROUNDING WIRE OF TRANSMISSION LINE" pps
... into one then this equivalent twoterminals network will have the characteristic matrix as follows: ATD = A1 × A2 ×K × An = An (A 1) Appling the Caylay-Hamilton theorem to solve (A 1), we have: ... equivalent circuit and use characteristic matrix method If we consider elementary parameters of each span to be equal, then each T -circuit will be considered as a two-terminals network having the ... have form as formula (3) (iii) The current which passes through the grounding system impedance of substations when lightning strikes at any point on the grounding wire of transmission line is calculated...
- 8
- 451
- 0
Báo cáo y học: "Acute pressure overload of the right ventricle. Comparison of two models of right-left shunt. Pulmonary artery to left atrium and right atrium to left atrium: experimental study" doc
... continuous variables and as percentages for categorical data The Kolmogorov - Smirnov test was utilized for normality analysis of the parameters The comparison of variables at each time point was performed ... Finally the measurements were taken at 10 and 20 minute interval The above parameters may alter the results of blood gases Nevertheless all measurements taken together allow for a realistic evaluation ... systemic arterial de-saturation following the PA-LA shunt was not increased dramatically with devastating consequences such as systemic oxygen delivery The advantages of a pulmonary artery to left atrium...
- 10
- 337
- 0
Broadband phase shifter design for phased array radar systems
... loaded -line phase shifter, the switched network phase shifter, the reflection type phase shifter and the vector based phase shifter The loaded -line phase shifter has the narrowest bandwidth and ... the formulas of conventional method as a special case, is found for the high- pass/low-pass phase shifter design, and closed-form equations for bandwidth enhanced and dual-band loaded -line phase ... insertion phase can be changed while its insertion loss remains the same Assume the reference state has an insertion phase of 1, and the phase shifting state has an insertion phase of 2, the phase...
- 199
- 297
- 0
Transmission line and and waveguide
... Equation for Hz 13 TE wave impedance: TM Wave 14 Transverse magnetic (TM) waves are characterized by: Cut-off wave number: Propagation constant: Helmholtz Wave Equation for Ez 15 TE wave impedance: ... Wave Equation for Ex For dependent, Laplace’s Equation TEM Wave (Cont.) Electric field can be expressed as the gradient of a Scalar potential also satisfies Laplace ‘s equation The voltage and current ... Poynting Vector 28 Attenuation 29 30 Outline 31 General Solutions for TEM, TE, and TM Waves Parallel Plate Waveguide Rectangular Waveguide Circular Waveguide Coaxial Line Surface Waves on a Grounded...
- 67
- 226
- 0
Báo cáo hóa học: " Research Article Blind Deconvolution in Nonminimum Phase Systems Using Cascade Structure" pptx
... into several easy subtasks The structure of demixing model is permutable because an anticausal scalar FIR filter is used 8 EURASIP Journal on Advances in Signal Processing Natural gradient-based ... system The key point of filter decomposition method [20] is to divide the nonminimum phase system into a minimum phase part and a maximum part, and then use a causal filter and an anticausal filter to ... China, in 1988 He became an Associate Professor in 1990 and then a Full Professor in 1995 at the Department of Automation, South China University of Technology He joined Laboratory for Advanced...
- 10
- 229
- 0
microwave circuit modeling using electromagnetic field simulation
... electrical lengths The software might use a Y-matrix, a cascade of ABCD parameter blocks, or a cascade of S-parameter blocks for the actual analysis At the ports, we typically ask for S -parameters ... fundamental approach to using these tools should be universal and easily applied to other areas Still, when I started this project my goal was to have a balanced number of examples from each of the major ... Simulation automatic or semiautomatic layout provided a quicker path to the finished circuit after analysis and optimization The greatest innovation in the 1990s was the emergence of CAD tools based...
- 488
- 730
- 0
Báo cáo sinh học: " Multivariate Bayesian analysis of Gaussian, right censored Gaussian, ordered categorical and binary traits using Gibbs sampling" pptx
... right censored Gaussian, categorical and binary traits using the Gibbs sampler and data augmentation The methodology was applied to analyse a simulated dataset and the results show that posterior ... (co)variance matrix (associated with the normally distributed scale of the model) is described as being “ad hoc in nature” The purpose of this paper was to present a fully Bayesian analysis of an ... Simulated data The simulated data consist of records on five-thousand animals First the complete data consisting of a Gaussian, a right censored Gaussian, an ordered categorical, and a binary trait are...
- 25
- 166
- 0
Supported group II transition metal catalysts in liquid phase reactions using borrowing hydrogen methodology 2
... Declaration I hereby declare that this thesis is my original work and it has been written by me in its entirety, under the supervision of Prof Stephan Jaenicke, (in the laboratory catalysis lab ... the thesis This thesis has also not been submitted for any degree in any university previously The content of the thesis has been partly published in: H H Liu, G K Chuah, S Jaenicke*, N-alkylation ... S5-04-04 and S5-02-02), Chemistry Department, National University of Singapore, between August 2008 and December 2012 I have duly acknowledged all the sources of information which have been used in the...
- 2
- 324
- 1
Supported group II transition metal catalysts in liquid phase reactions using borrowing hydrogen methodology 1
... together with a copper co-catalyst using an amine as solvent [62] Besides copper as the co-catalysts, Ag also was used as the co-catalysts for this type of reactions Palladium-catalysed decarboxylative ... temperature to 90 oC Besides urea, other bases such as KOH or NaOH can also be used The Au/TiO2 [12] catalyst reported by Cao’s group was prepared by a deposition of Au onto TiO2 at pH = adjusted by ... catalyst can be prepared by starting with a high surface area porous support, such as alumina, which is then dosed with a precursor for the active phase The impregnation can be achieved by various...
- 221
- 658
- 0
Sự khác biệt giữa LEFT JOIN , RIGHT JOIN , INNERJOIN
... in: SELECT Employees.Name FROM Employees, Orders WHERE Employees.Employee_ID = Orders.Employee_ID AND Orders.Product = ‘Printer’ kết trả về: Name Hansen, Ola Sử dụng JOIN Ta sử dụng từ khoá JOIN ... bảng thứ hai (Orders) Nếu có dòng bảng Employees không ứng với dòng bảng Orders dòng tính kết trả về: Name Hansen, Ola Svendson, Tove Svendson, Stephen Svendson, Stephen Pettersen, Kari Product ... với dòng bảng Employees dòng tính kết trả về: Name Hansen, Ola Svendson, Stephen Svendson, Stephen Ví dụ: Ai đặt hàng máy in: SELECT Employees.Name FROM Employees INNER JOIN Orders ON Employees.Employee_ID...
- 3
- 13,035
- 29
Báo cáo khoa học: An engineered right-handed coiled coil domain imparts extreme thermostability to the KcsA channel docx
... KcsA channel Table DNA sequence of the synthesized rhcc gene ACCGTTATCATCGACGACCGTTACGAATCTCTGAAAAACCTGATCACCCTGCGTGCGGACCGTCTGGAAATGATTATCAACGACAACGTTTCTACCATCCTGGCGTCAATT TGA GAATTCTCATTAAATTGACGCCAGGATGGT-3¢ ... selection was therefore used to identify the optimal splice variants Both RHCC and left-handed coiled coils were used as target candidates and our algorithm easily identified the RHCC as better candidates ... recordings for KcsA–RHCC at pH and 8, respectively The open and closed states are indicated at the bottom of the chart NPo values at pH and are indicated above the graphs They are indicative of the mean...
- 11
- 395
- 0
Báo cáo khoa học: "Left-to-Right Target Generation for Hierarchical Phrase-based Translation" doc
... improvement against a phrase-based modeling Chiang (2005) introduced a hierarchical phrasebased translation model that combined the strength of the phrase-based approach and a synchronous-CFG formalism ... present a target-normalized hierarchical phrasebased translation model The model is a class of a hierarchical phrase-based model, but constrained so that the English part of the right-hand side The ... three non-terminals did not increase the grammar size The hierarchical phrase-based translation model extracts twice as large as our target-normalized formalism The target-normalized form is restrictive...
- 8
- 232
- 0
Báo cáo khoa học: "DETERMINISTIC LEFT TO RIGHT PARSING OF TREE ADJOINING LANGUAGES*" ppt
... entry of the action table, the grammar is not LR(0): there is a conflict of action, the grammar cannot be parsed deterministitally without lookahead An example of a finite state automaton used for ... applied at left completion stage, an encoding of the fact that left part of/ 3 (as well as the left part of trees adjoined on the spine of/ ~) has been completed has to be restored in the storage ... three parts (ACTION, GOTOright and GOTO.foot) The parsing program is the same for all LR parsers, only the parsing tables change from one grammar to another The parsing program reads characters...
- 8
- 218
- 0
From business strategy to IT action right decisions for a better bottom line
... NIE Practice 5: Performance Measurement — Measures IT performance in ways that relate to the business It is easy to measure IT’s performance in operational and tactical terms It is hard to measure ... budgets and plans We need them to work together consistently But companies already this, managers may say They work to improve the bottom -line performance of their company.5 From year to year, they ... He has worked with a large number of clients in the USA, Canada and Europe on critical IT measurement and management issues Mr Walton applies a combination of active research and practical experience...
- 354
- 577
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25