level of the toe strength of function where analysis shows that the function provides adequate protection against deliberately planned or organized breach of the toe security by attackers possessing a high attack potential 19
Báo cáo y học: "Gene function and expression level influence the insertion/fixation dynamics of distinct transposon families in mammalian introns" doc
... in mammalian species other than human and mouse We therefore analyzed MIR frequency in dog, as well as in our most distant extant mammalian ancestors, namely metatherian To this aim we searched ... the actual data [70] Additional data files The following additional data are available with the online version of this paper Additional data file contains suppleGenome Biology 2006, 7:R120 information ... species (human, mouse and dog) Given the partially independent origin of MIR sequences in eutheria and metatheria, it is important to notice that analysis of orthologous genes indicated that MIR over-representation...
- 15
- 378
- 0
An investigation into the reality of teaching and learning speaking skills to the 2nd year non-major english students at pre-intermediate level of proficiency at hanoi university of industry
... great importance to the achievement of my academic study It is my pleasure to acknowledge my debt to the Board of Management of Foreign Languages Department for their support and the favorable conditions ... ABSTRACT It is the fact that speaking is an important language skill However, in the reality, the teaching and learning English speaking are still far from satisfactory The study focuses on the ... DEPARTMENT OF POST GRADUATE STUDIES CANDIDATE’S STATEMENT I certify that the minor thesis entitled: “An investigation into the Reality of Teaching and Learning Speaking Skills to the 2nd year non-major...
- 20
- 2,397
- 27
The 11th form non-english majors’ level of satisfaction with their reading comprehension lessons at phan boi chau specialized upper secondary school, nghe an
... was argued that vocabulary is an important ingredient of language and vocabulary learning is an essential part of second or foreign language learning Language learners need a wide array of target ... self-confidence for a language task by means of “self-talk” (an affective strategy) A learning strategy is a series of actions a learner takes to facilitate the completion of a learning task A strategy starts ... new language by many different means” The first letters of these strategies sets create the acronym “PRAC” as a memory aid of the essence of these strategies “CS are PRACtical for language learning”...
- 46
- 835
- 3
THE 11TH FORM NON ENGLISH MAJORS’ LEVEL OF SATISFACTION WITH THEIR READING COMPREHENSION LESSONS AT PHAN BOI CHAU SPECIALIZED UP
... language and into the process of language learning have changed The second reason is that learner-centredness is not a theory about teaching, but rather a theory about learning Each individual ... interpret the questionnaire data more accurately .The study was carried out on the basis of material collection, survey questionnaire and class observation For the theoretical basic, materials are collected, ... show their performance and competence, but they also have the ability to develop and create what they have learnt In the teaching and learning foreign language, this approach brings a lot of advantages...
- 30
- 367
- 0
Teaching speaking skill to non english major students of pre intermediate level at the people’s police academy some suggested techniques and activities
... Despite the fact that the teachers at the PPA are well aware of the benefits of CLT, many of them admit that they find it hard to apply CLT into their teaching According to them there are many reasons ... effectiveness of teaching process Let’s take the use of authentic materials as an example Teachers at the PPA have realized the importance of authentic materials in English language learning and teaching ... materials In order to learn a language, learners need as mush as possible to hear and read the language as native speakers use it Therefore, access to authentic materials is of great importance...
- 40
- 1,122
- 1
Tài liệu Priority Setting for Reproductive Health at the District Level in the context of Health Sector Reforms in Ghana doc
... goals and international targets that Ghana has signed on to, rather than allocation within a particular sector The concern among senior managers within the health sector is that the sector may ... exemptions for antenatal care and deliveries in addition to family planning and immunization At the time of the study, Ghana was introducing a national health insurance scheme It is anticipated that the ... workshops are then organized at the national, regional and district levels to orientate managers in the priorities for the year and in the tools and process for planning Each district then develops...
- 42
- 1,428
- 0
Tài liệu Báo cáo khoa học: TEC family kinases in health and disease – loss-of-function of BTK and ITK and the gain-of-function fusions ITK–SYK and BTK–SYK pptx
... X-linked agammaglobulinemia A clinical and molecular analysis Medicine (Baltimore) 75, 287–299 Plebani A, Soresina A, Rondelli R, Amato GM, Azzari C, Cardinale F, Cazzola G, Consolini R, De Mattia D, ... when the protein remains stable, by acting as a dominant negative form, or by interfering with other functional parts of the molecule Thus, as a functional SH2 domain is necessary for enzymatic activity, ... kinases and disease A Hussain et al ITK–SYK, but not ITK or SYK themselves, is capable of transforming NIH-3T3 cells [70] In addition, we and others have demonstrated that the activation and plasma...
- 10
- 926
- 0
Báo cáo khoa học: Insulin resistance in human adipocytes occurs downstream of IRS1 after surgical cell isolation but at the 1 level of phosphorylation of IRS1 in type 2 diabetes pot
... resistance that results from minor and major surgical procedures, a small incision during local anaesthesia had a similar effect to abdominal surgery under general anaesthesia on ERK1 ⁄ in the adipocytes ... unphosphorylated in fresh adipocytes and unaffected by overnight recovery We therefore exclude insulin as causing the basal activation of MAP-kinases; especially as we found that a substantial degree of ... noted that the analyses of insulin effects on glucose transport and the different signal mediators of the hormone were performed on the same cell sample from the same individual Responses for the...
- 11
- 472
- 0
Báo cáo Y học: A novel gain-of-function mutation of the integrin a2 VWFA domain docx
... underlined): for E318 to W, 5¢-TTCAATGTGTCTGATTGGGCAGCTCTACTAGA AAAGGCTG-3¢; for E318 to I, 5¢-CAATGTGTCTGA TATAGCAGCTCTACTAGAAAAG-3¢; for E318 to R, 5¢-CAATGTGTCTGATCGAGCAGCTCTACTAGAAA AG-3¢; for E318 ... shown that the ligand binding function of the aL and aM VWFA domains can be modulated by controlling the conformational state of the domain The majority of approaches have directly targeted the a7 ... noncollagenous ligands of a2 b1 These data indicate that E318W has a similar effect on a2 as F302 does on aM and that residue E318 has an important role in modulating a2 VWFA domain function MATERIALS...
- 9
- 471
- 0
Bringing the Hidden Giants to the Footlight: the Role of Savings and Retail Banks in Increasing the Level of Access to Financial Services docx
... concentrate on the analysis of the creditworthiness and the repayment capacity of their clients, a domain where they have a high level of expertise, while savings banks could make use of their ... essential to collect the often small amounts of savings, and maintain them at the disposal of the client on a permanent basis It requires skilled staff, good treasury management and adequate control ... Savings Bank) has a “School Based Savings Programme” in which students recreate a savings bank in their class and acquire the basic principles of personal financial management via a “learning by...
- 4
- 511
- 0
Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc
... ML, Maisetta G, Di Luca M, Gaddi LM, Esin S, Florio W, Brancatisano FL, Barra D, Campa M & Batoni G (2008) Comparative analysis of the bactericidal activities of amphibian peptide analogues against ... permeation/proteome proteome of the target microorganism and no microbial resistance; and (b) the design of potential coadjuvants of those antimicrobial agents that are already available after ... We thank M Simmaco for use of the facilities and platforms available in the DiMA Unit of the Sant’Andrea Hospital This work was funded in part by Italian ` Ministero dell’Universita e Ricerca (PRIN...
- 18
- 494
- 0
Báo cáo Y học: Loss-of-function variants of the human melanocortin-1 receptor gene in melanoma cells define structural determinants of receptor function doc
... it can be hypothesized that an impairment of the normal function of the aMSH/MC1R system as a result of loss -of- function mutations in the MC1R gene, might lead to an increased risk of melanoma ... Arg151Cys and Arg142His alleles and a new variant not reported so far, to the best of our knowledge, the Leu93Arg allele That this variant was indeed present in the sample and was not the result of a ... Arg151Cys variants, no functional data are available for the new Leu93Arg allele Although the unresponsiveness of the IC8 HMC line suggested that it may correspond to a loss -of- function mutation,...
- 9
- 356
- 0
Báo cáo khoa học: Inhibitors of protein phosphatase 1 and 2A decrease the level of tubulin carboxypeptidase activity associated with microtubules pptx
... CPA/ACPA), where Ano CPA and ACPA are the absorbances of the control and CPA-treated samples, respectively Provided that the numerator and the denominator correspond to identical samples, this expression ... Rodriguez, J .A. , Barra, H.S & Caputto, R (197 8) Capability of tubulin and microtubules to incorporate and to release tyrosine and phenylalanine and the effect of the incorporation of these amino acids ... this point are underway Acknowledgements ´ We thank C .A Argarana and C.R Mas for critical reading of the ˜ manuscript; S.N Deza and M.G Schachner for technical assistance, and S Anderson for English...
- 9
- 301
- 0
Báo cáo khoa học: Proteome analysis at the level of subcellular structures Mathias Dreger pot
... biochemistry-oriented laboratories for decades The efficiency of the subcellular fractionation was assessed based on the determination of marker enzyme activities, and a major analytical goal was the identification ... mass spectrometry along with the availability of comprehensive protein and DNA databases that made easy and quick protein identification feasible The analytical tools that are available nowadays ... maturation of the organelle was monitored by comparative analysis of phagosomes in different stages The authors demonstrated that the phagosomes acquire cathepsins, key catabolic enzymes of mature...
- 11
- 493
- 0
CEEH Scientific Report No 3: Assessment of HealthCost Externalities of Air Pollution at the National Level using the EVA Model System docx
... (anthropogenic: GEIA/EDGAR; NEC-II + natural international ship traffic as All/15 for the year 2020) Appendix A Figure A1 A2 A3 A4 A5 A6 A6 A8 A9 A1 0 A1 1 -A1 3 A1 4 A1 5 A1 6 A1 7 A1 8 A1 9 A2 0 -A2 2 A2 3 ... far away can also have significant and equally important impacts as nearby sources Therefore the main aim of this work is to examine all the major emission sectors in Denmark and to quantify their ... is applied that is a combination of the EU thematic strategy for clean air in Europe and scenarios for the 27 EU countries made by the International Institute for Applied Systems Analysis (Amann...
- 98
- 634
- 0
Báo cáo khoa học: The phosphatidylethanolamine level of yeast mitochondria is affected by the mitochondrial components Oxa1p and Yme1p ppt
... CAGGTATGTGGTTCCAAGTGTTTGTCGCTCTTTGAATTTGGAATTCGAGCTCGTTTAAAC TCTAATACGACTCACTATAGGGAGAATGTCAATTATGCCAGTTAAG CTTTACATATGATTGCTTTCATTTTAAATCATTCTTTCC AGAACTGCGGTGCTATGGAATAGA TTTGGCACGATCCACAATCTC an overnight culture and cells ... GTTCACGTACAAGCGGAGCCACAGAATAACCTCCCCGACGCGGATCCCCGGGTTAATTAA GTTTTATATTTTTATATTTACAGAGAGATATAGAGCCTTTATGAATTCGAGCTCGTTTAAAC GCCAGTTAAGAACGCCTTGGCGCAAGGGAGGACGCTCCTCCGGATCCCCGGGTTAATTAA CAGGTATGTGGTTCCAAGTGTTTGTCGCTCTTTGAATTTGGAATTCGAGCTCGTTTAAAC ... rate for PSD1 and a defect in Psd1p maturation are the molecular basis of the decreased rate of PtdSer decarboxylation in oxa1D mitochondria One obvious explanation for the decreased amount of...
- 11
- 354
- 0
báo cáo sinh học:" Measuring and managing the work environment of the mid-level provider – the neglected human resource" pdf
... collection and analysis FM participated in the data collection, data cleaning and preliminary analysis MM and DH conducted the data analysis and wrote part of the results section of the paper MC ... Malawi, and provides evidence of the factors that influence motivation, staff satisfaction and retention Methods The conceptual framework for this study is the Managing for Performance framework ... enrolled and auxiliary nurses was also stopped in Ghana and Zambia However, Dovlo argues that as these cadres have developed, and as delegation of tasks has been accompanied by delegation of responsibility,...
- 9
- 455
- 0
báo cáo hóa học: " Astrocyte production of the chemokine macrophage inflammatory protein-2 is inhibited by the spice principle curcumin at the level of gene transcription" pptx
... from Dako Corp (Carpinteria, CA) Preparation and culture of astrocytes: Astrocytes were prepared from the brains of neonatal (3 to 7-day-old) CBA/ CaJ mice by a modification of the method of Pousset ... treatment of inflammatory conditions of the CNS Methods Mice Six to eight-week-old CBA/CaJ mice were purchased from Jackson Laboratories (Bar Harbor, ME) and bred in our animal facility Materials ... experimental allergic encephalitis (EAE) and traumatic injury of the brain, the CXC chemokine, macrophage inflammatory protein-2 (MIP-2) appears to play a pivotal role in the induction and perpetuation...
- 7
- 385
- 1
báo cáo hóa học:" The influence of the level of physical activity and human development in the quality of life in survivors of stroke" potx
... parameters for each indicator and the normalization is given by an equation that measures the distance between the observed value for the indicator and the minimum value as a proportion of the ... FJA and DGM conceived the study NG, ALC, AJS participated in data collections of the study, VR conducted data analysis RJO and RCH participated in interpretation of data and manuscript preparation ... years after acute myocardial infarction: short form 36 scores compared with a normal population Heart 199 9, 81:352-8 18 Hallal PC, Victora CG: Reliability and validity of the International Physical...
- 6
- 509
- 0
Research report: "The w - the germ of function defined on the manifold r-reticular" ppsx
... j (x, t) = This implies that and is flat for , and differentiable for t Therefore by the existence of solutions of a differential equation, it follows that for the equation h t = (h(x, t), t), ... results of J Mather, in [1], [5] If and f is a function germ, then we obtain the result of V I Arnold, in [1] (3) If r=1 Remark and f is a map germ, then we have results of H H Vui, in [8] We have ... stability, Ann Math., 89 (196 9), 254-291 [7] D Siersma, Singularities of functions on boundaries, corners, Quart J Math Oxford (2) 32 (198 1), 119 - 127 [8] H H Vui, Some properties of Taylor of...
- 7
- 209
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008