judging of the soundness and general worth of statements as a fourth factor in study
Báo cáo khoa học: "Mutation and overexpression of p53 as a prognostic factor in canine mammary tumors" pptx
... Immunohistochemical analysis of MIB-1, as a proliferative marker is a good approach for evaluation of the growth fraction [4,13] MIB-1 is a monoclonal antibody against recombinant parts of the Ki-67 antigen and ... several parameters All statistical analyses were performed with software package SPSS (Release 8.0, SPSS inc.) and a P-value of
- 7
- 325
- 0
báo cáo khoa học: "A Study to investigate the role of p27 and Cyclin E immunoexpression as a prognostic factor in early breast carcinoma" pptx
... spread and vascular invasion with distant metastases free survival (MFS) in all invasive carcinomas and the subgroup of IDC in an univariate analysis However, there was no significant association ... carcinomas [9] But the labelling index of cyclin D1 correlated with the pathological stage of the disease in invasive lobular carcinomas but not in invasive ductal carcinomas Another study evaluated ... prognostic value as there is a direct statistical association with the development of distant metastases in all invasive carcinomas, the subgroup of invasive ductal carcinomas and in the node negative...
- 9
- 423
- 0
A contrastive analysis of encouraging as a speech act in english and vietnamese
... and learning of communication in a foreign language and partly in Communicative encouraging in English and Vietnamese as a speech act Language Teaching 1.3 SCOPE OF THE STUDY 1.2 AIMS AND OBJECTIVES ... emergence of English as an international language in this century, there are a great number of the Vietnamese people who learn and speak English In fact, in learning English as a foreign language, the ... STATEMENT OF THE PROBLEM teachers and learners of English as well as other potential interactants In the past, a series of studies regarding different speech acts of international communication...
- 13
- 1,583
- 8
Báo cáo y học: "Screening of an endothelial cDNA library identifies the C-terminal region of Nedd5 as a novel autoantigen in systemic lupus erythematosus with psychiatric manifestations" ppt
... statistical analysis and the clinical associations AS participated in the analysis and interpretation of data and in the revision of the manuscript RR participated in the design of the study and in the ... PM carried out the screening of the library and participated in the design of the study and in the analysis of data MS carried out the experiments on endothelial cell line and apoptosis and participated ... cloning and sequencing of cDNA and protein expression and contributed in the interpretation of data MR carried out the ELISA experiments and participated in analysis of data CA performed the statistical...
- 8
- 375
- 0
Báo cáo y học: "Assessing post-traumatic stress disorder in South African adolescents: using the child and adolescent trauma survey (CATS) as a screening tool" docx
... bodies, and parents and learners was also obtained Learners and their parents/guardians were informed that participation was entirely voluntary Consent forms were handed to parents/guardians for ... staff The order of administration of the CATS and K-SADS was counterbalanced to control for practice effects The evaluation per participant took approximately 45 minutes Data Analysis Microsoft ... Mental Health 2000, 12:38-44 American Academy of Child and Adolescent Psychiatry: Practice parameters for the psychiatric assessment of children and adolescents Journal of the American Academy of...
- 10
- 667
- 0
Characteristics of olivine as a bed material in an indirect biomass gasifier
... level of 30% was assumed in the raw gas Results 5.1 Tar yields The effect of olivine in reducing the amount of tar in the raw gas, as compared to the silica sand, is one of the main advantages of ... slag in the form of Na2O and NaAlO2 In the case of a reaction between the slag and raw gas, it was predicted that Na would remain in the same form The same result was obtained for the reaction ... shows the results of the analysis of the bed material, as provided by ALS Scandinavia AB The analysis encompasses the main elements in the samples collected from the seal entering the gasifier...
- 12
- 372
- 0
The special and general theory of relativity a einstein
... Special and General Principle of Relativity XIX The Gravitational Field XX The Equality of Inertial and Gravitational Mass as an Argument for the General Postulate of Relativity XXI In what Respects ... (co-ordinate system) An observer in the train measures the interval by marking off his measuring-rod in a straight line (e.g along the floor of the carriage) as many times as is necessary to take ... transformation.” If in place of the law of transmission of light we had taken as our basis the tacit assumptions of the older mechanics as to the absolute character of times and lengths, then instead...
- 152
- 414
- 0
Báo cáo khoa học: Characterization of the tRNA and ribosome-dependent pppGpp-synthesis by recombinant stringent factor from Escherichia coli pot
... is easy to manipulate binding of unacylated tRNA to the ribosome by increasing the magnesium concentration [14] The magnesium concentration also affects the binding states of the tRNAs on the ... containing only unacylated tRNAs Here, it should also be mentioned that it has been suggested that the 50S subunit may contain a domain that senses the aminoacylation state of the tRNA in analogy ... contain tRNAs bound in classical states This means that the 50S A- and P-sites interacted with the 3¢ end of unacylated tRNAPhe and tRNAMet , respectively Thus, in this study, SF was actif vated...
- 11
- 446
- 0
Báo cáo khoa học: The oxidative effect of bacterial lipopolysaccharide on native and cross-linked human hemoglobin as a function of the structure of the lipopolysaccharide A comparison of the effects of smooth and rough lipopolysaccharide ppt
... Mansouri and Winterhalter [5] reported that the oxidation of the a chains of Hb A0 was 10 times faster than that of the beta chains and that the oxidation of the beta chains was not in uenced by pH The ... presence of EDTA The rough S minnesota LPS increased the initial fast phase of the reaction, but decreased the rate of the slow phase of oxidation in the presence of EDTA A comparison of rough and ... during the auto-oxidation of Hb In general, the increase in the oxidation rate of crosslinked Hb mediated by LPSs is due to an increase in the rate of the initial fast phase, i.e oxidation of the a...
- 6
- 748
- 0
Gradual phase and morphology transformation of Fe3O4nanoparticles to a - FeOOH nanorods in alcohol/water mediain the presence of surfactant F127
... with 52% of Fe3O4 in mass and 48% of a- FeOOH in mass Results and discussion Figure shows XRD patterns of the samples prepared in pure water and in alcohol/water media XRD pattern of Fig 1a matches ... in pure water and in alcohol/water media is also investigated, as shown in Fig The value of saturation magnetization of samples a, b, and c is 75.4 emu/g (Fig 3a) , 39.2 emu/g (Fig 3b), and (Fig ... It reveals the coexistence of two phases in the product From the above results, a gradual phase transformation from Fe3O4 to a- FeOOH can be seen with increasing volume ratios of alcohol/water Fig...
- 4
- 658
- 0
báo cáo hóa học: " Adalimumab improves health-related quality of life in patients with moderate to severe plaque psoriasis compared with the United States general population norms: Results from a randomized, controlled Phase III study" pdf
... baseline visit: moderate to severe plaque psoriasis defined as ≥ 10% BSA involvement, a PASI score of ≥ 12 and a Physician's Global Assessment of at least moderate disease The REVEAL study was ... contributions DAR, MK, NH, and MKW designed and interpreted the analysis of health-related quality of life data AM and SF assisted Abbott Laboratories with the original Phase III study design and acquisition ... age, sex, and race Sample size for adalimumab group at baseline and Week 16: n = 805 and n = 775 Sample size for placebo group at baseline and Week 16: n = 396 and n = 354 Analysis of covariance...
- 8
- 518
- 0
Báo cáo hóa học: "Research Article On the Nonexistence and Existence of Solutions for a Fourth-Order Discrete Boundary Value Problem" doc
... have verified all the assumptions of Lemma 2.2 and hence −J has at least a critical point in Rk This completes the proof 16 Advances in Difference Equations Finally, we consider the special case ... oscillatory properties of certain fourth order nonlinear difference equations,” Journal of Mathematical Analysis and Applications, vol 322, no 2, pp 930–956, 2006 13 E Thandapani and I M Arockiasamy, ... , the above inequality means that there exists a lower bound of values of functional J Classical calculus shows that J attains its minimal value at min{J u | u ∈ Rk } Clearly, u is a critical...
- 18
- 371
- 0
Báo cáo y học: "Identification and characterization of the carboxy-terminal region of Sip-1, a novel autoantigen in Behçet''''s disease" docx
... the protein Sip1 Sip1 is a nuclear splicing factor containing an arginine/serine-rich domain and a RNAbinding motif that may play a role in linking the processes of transcription and pre-mRNA ... participated in the design and revision of the study and performed the statistical analysis RP participated in the design and revision of the study AS participated in the analysis and interpretation ... of data and helped to draft the manuscript RR participated in the design of the study and in the revision of the manuscript EP participated in analysis of data GV participated in the design of...
- 8
- 550
- 0
Báo cáo khoa hoc:" Papillary carcinoma arising in a thyroglossal duct cyst with associated microcarcinoma of the thyroid and without cervical lymph node metastasis: a case report" pot
... given as an adjuvant treatment The patient has been following without any metastasis for two years Discussion A mass in the neck is a common clinical finding and differential diagnosis may be ... carcinoma arising from metaplastic columnar cells that line the duct [1] More then 200 cases of thyroglossal duct carcinomas have been reported in which papillary carcinoma accounts for 80% of cases, ... or hard masses in the midline of the anterior neck, and are nontender and generally movable Malignant thyroglossal duct cysts present in the same manner Carcinoma should be suspected in any thyroglossal...
- 3
- 311
- 0
Báo cáo y học: "Rapid and persistent selection of the K103N mutation as a majority quasispecies in a HIV1-patient exposed to efavirenz for three weeks: a case report and review of the literature" pot
... reinforcing at the same time the need for a systematic evaluation of GRT in naïve patients and after any type of interruption of NNRTI-based HAART regimens, as well as the need for a wise strategy ... have a case to share? Submit your case report today • Rapid peer review • Fast publication • PubMed indexing • Inclusion in Cases Database Any patient, any case, can teach us something www.casesnetwork.com ... days after his last check in 2003, approximately three weeks after therapy simplification (Figure 1) Neither a preNNRTI GRT assay was available at that time, nor samples of plasma drawn in advance...
- 5
- 427
- 0
Tài liệu The Man of Letters as a Man of Business docx
... that because they have the affair altogether in their hands they are apt to take advantage in it; but this does not follow, and as a matter of fact they have the affair no more in their own hands ... often a lasting death An interesting proof of the value of the magazine to literature is the fact that a good novel will have wider acceptance as a book from having been a magazine serial I am ... of the Man of Letters as a Man of The Man of Letters as a Man of Business, by Business, I shall attract far more readers than I should in writing of him as an Artist Besides, as an artist he has...
- 21
- 544
- 0
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx
... were dried and autoradiographed Competitor DNAs used in EMSA analysis were: NF1 wt, 5¢-TTTTG GATTGAAGCCAATATGATA-3¢; NF1 mut, 5¢-TTTT GGATTGAATAAAATATGATA-3¢; Site-2 wt, 5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT ... and Site-3 binding activity in all fractions was monitored by the in vitro DNase I protection assay The DNA affinity column, used as the last step in the purification, was prepared with an oligonucleotide ... performed as by Li et al [11] Five micrograms of reporter plasmid DNA containing the CAT gene and lg of control luciferase plasmid DNA (pGL3, Promega) were used for transfection CAT and luciferase activities...
- 8
- 426
- 0
Báo cáo khoa học: Mechanisms of amyloid fibril self-assembly and inhibition Model short peptides as a key research tool pptx
... (e.g including a domain of 42 or more amino acids in the case of Huntington-related polyglutamine repeats) or formed over a longer timescale (days and weeks compared with minutes in the case of the ... practical point of view, understanding of the mechanism of amyloid formation that is indeed associated with the interaction of aromatic moieties has a direct clinical importance Also important ... role in the fibrillization process [27] The results of a systematic alanine-scan of a shorter IAPP fragment (Table 1) indicated that other than phenylalanine, any amino acid within the fragment...
- 8
- 440
- 0
![Báo cáo khoa học: Properties and significance of apoFNR as a second form of air-inactivated [4Fe-4S]ÆFNR of Escherichia coli pot](https://media.store123doc.com/images/document/14/rc/at/small_ata1395562826.jpg)
Báo cáo khoa học: Properties and significance of apoFNR as a second form of air-inactivated [4Fe-4S]ÆFNR of Escherichia coli pot
... concentration was determined using the Bradford assay [32] and the radioactivity was measured in a scintillation counter Radioactivity was corrected for not incorporated radioactivity by measuring and subtracting ... of fragments of aerobically and anaerobically prepared apoFNR after treatment with iodoacetic acid and digestion with protease AspN The numbering of the peptides gives the first and the last amino ... evaluation of thiol and disulfide containing peptides of aerobically and anaerobically prepared apoFNR Aerobically or anaerobically prepared apoFNR were incubated with GnHCl + iodoacetate and digested...
- 10
- 477
- 0
Test of English as a Foreign Language for Internet-Based Testing: Information and Registration BULLETIN
... and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Bahamas Bahrain Bangladesh Barbados Belarus Belgium Belize Benin Bermuda Bhutan Bolivia Bosnia and Herzegovina Botswana Brazil ... Kiribati, Laos, Macau, Malaysia, Marshall Islands, Micronesia, Mongolia, Myanmar, Nepal, New Caledonia, New Zealand, Northern Mariana Islands, Pakistan, Palau, Papua New Guinea, Philippines, ... Dominican Republic, Ecuador, El Salvador, Grenada, Guadeloupe, Guatemala, Guyana, Haiti, Honduras, Jamaica, Martinique, Mexico, Netherlands Antilles, Nicaragua, Panama, Paraguay, Peru, St Lucia,...
- 28
- 764
- 2
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25