jl thompson dc 2004 application of proteomic technologies in the drug development process toxicol lett 149 377 385
Expression dynamics of the hepatic mitochondrial proteome of the sod2+ mouse in response to troglitazone administration
... defined as having experimental in vitro or in vivo evidence of one or a combination of the following traits: depolarization of the inner transmembrane potential due to either uncoupling or inhibiting ... crossing a threshold at the point -of- no-return • Continued course of disease, in some severe cases despite discontinuation of drug administration, consistent with the concept of accumulation of ... consensus sequence interacts with the DNA-binding domains of PPARγ and RXRα and shields the highly polar side chains of the interacting residues (Asn 160 from PPARγ, and Arg 209 and Gln 206 of RXRα) from...
- 226
- 1,830
- 0
Tài liệu Báo cáo khoa học: Altered inactivation pathway of factor Va by activated protein C in the presence of heparin doc
... facilitated the determination of loss of FVa cofactor activity during the initial stage of inactivation and minimized the in uence of the k306 Ó FEBS 2004 Heparin and APC-catalyzed inactivation of FVa ... transferred into new reaction tubes containing either heparin or buffer Monitoring of FVa activity in these two tubes was continued for another 25 min, during which time the loss of FVa activity in the ... part of the heparin-binding site in these three crystallized protein–heparin complexes were given as starting point for the docking search [30] At least one conformation of the simulated protein–peptide...
- 13
- 654
- 0
Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt
... side chain slithers along the side of the protein surface, whereas in the M100K structure it points out into the solvent (Fig 4C) The position of the K99 side chain is also different In the wt ... prominent being the absence of the 695-nm band, indicative of Met-Sdiron coordination Upon titrating increasing amounts of guanidinium hydrochloride (GdmHCl) the protein unfolds resulting in the perturbation ... the coordinating K100, with the H-bonded water molecule found in the X-ray structure increasing the electron donating power of the coordinating amino group which in turn can decrease the reduction...
- 15
- 509
- 0
Báo cáo Y học: Cloning and expression of sterol D14-reductase from bovine liver potx
... bovine D14-SR, regions of the deduced amino-acid sequence corresponding to the N-terminal and V8 peptide sequences determined in the sequencing experiments of the protein puri®ed from bovine ... localization of the enzymes involved in cholesterol biosynthesis and with the puri®cation of the bovine protein from the ER Determination of D14-SR activity To demonstrate that the cloned bovine liver ... Press, Cold Spring Harbor, NY, USA 33 Bradford, M.M (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding Anal Biochem...
- 8
- 493
- 0
Báo cáo khoa học: Selective detection of superoxide anion radicals generated from macrophages by using a novel fluorescent probe pdf
... between the fluorescence intensity and O2–Æ concentration To assess the selectivity of the method, the effect of other ROS and biological compounds on the determination of 3.33 lm O2–Æ was examined individually ... radicals In order to further investigate the feasibility of the proposed method in biological systems, determination of O2–Æ in cell extracts was performed The fluorescence intensity of cell extracts ... shown in Fig 8, the fluorescence intensity of reaction system increased with increasing time up to 10 and became constant thereafter This shows that the probe can capture O2–Æ quickly within 10 min,...
- 9
- 401
- 0
Báo cáo khoa học: Identification of a copper-repressible C-type heme protein of Methylococcus capsulatus (Bath) A member of a novel group of the bacterial di-heme cytochrome c peroxidase family of proteins docx
... residues of both the heme-binding sites (CxxCH), in addition to the amino acids coordinating the calcium ion present in the interface domain of the solved CCPs are positionally conserved in MCA2590 ... located in the core of the CCP structure (Fig 3A) Furthermore, all of the additional insertions of the extended MCA2590 sequence are introduced in loop regions on the surface of the structure, thereby ... elements Furthermore, the majority of the conserved residues were buried amino acids, thereby maintaining the structural integrity of an N europaea CCP-similar fold of SACCP, and thus bringing the hemes...
- 12
- 392
- 0
Báo cáo khoa học: "PCR-based detection of genes encoding virulence determinants in Staphylococcus aureus from bovine subclinical mastitis cases" doc
... :drawrof CGAAATCAAGCAGTTCCGAACGCA :esrever TTGGCATAGTGGTAGTTAGC :drawrof TACAGCAATTTGGACCAC :esrever AAGGAGAAAACCACGAAC :drawrof CTCCTTCTGTTGTTGTTCGG :esrever GCGTCGTAAACGTCGTCCAC :drawrof CGTAGCTTGTTAGCCTTCG ... )1 : 42( lohocla lymaosi :mroforolhc dna )1 : 1( mroforolhc :lonehp htiw noitcartxe yb deifirup saw AND Co56 ta nim 03 rof detabucni dna )lCaN M 7.0 ni edimorb muinomma lyhtemirt lycedaxeh %01( ... .nim 01 rof Co27 ta noisnetxe lanif dna nim rof Co49 ta noitarutaned laitinI ces 54-Co27,ces 03-Co85 ,nim 3-Co49 selcyc 03 :4 ;ces 06 -Co27,ces...
- 4
- 138
- 0
Tài liệu Int’l High Performance Network Infrastructure of Korea doc
... framework of APEC member economies - in response to G7’s GII, Clinton Admin’s NII etc At APEC TELMIN1 in Seoul (1995), the five objectives of APII were defined 1) construction of information infrastructure ... Malaysia Singapore Indonesia Access Point Exchange Point TEIN APII Testbed Australia Int’l ICT, IR, Asia Pacific Information Infrastructure At APEC Summit2 in Bogor (1994), APII was introduced ... APII-TC(Japan) play a leading role >> Incentives are needed for inviting more partners Int’l ICT, IR, 12 TEIN Initiative: Background Cooperation Between EU and Asia After the Cold War, the int’l society...
- 30
- 362
- 0
Báo cáo khoa học: Injection of poly(b-L-malate) into the plasmodium of Physarum polycephalum shortens the cell cycle and increases the growth rate pot
... significantly in comparison with the mock-injected plasmodia, the overall changes being similar for the two strains and independent of the injection times Following injection of 400 lg PMLA, the decrease ... the same for the white and the yellow strains Nevertheless, because the level in the cytoplasm of white plasmodia before injection was very low (Table 1), the relative increase in these strains ... measurements are indicated Transient appearance of histone H1 in the cytoplasm We suspected that the mechanism(s) underlying the increase in the growth rate and the shortening of the cell cycle...
- 7
- 325
- 0
Child Health And The Quality Of Medical Care by Sarah L. Barber University of California, Berkeley ppt
... long-term constraints The reduced-form is obtained by substituting the determinants of the chosen health behaviors into equation (1) for the xht To derive the determinants of the xht, we make the standard ... thalidomide, smoking, and alcohol and drug abuse The long-term effects of such insults ultimately depend on a range of interrelated factors, including maternal health status and the timing of the insult ... combination of both, the environment is unable to compensate for the drop in the growth trajectory Such a decline reinforces the importance of promoting health during critical periods of development...
- 53
- 369
- 0
Báo cáo khoa học: Novel L-amino acid oxidase with antibacterial activity against methicillin-resistant Staphylococcus aureus isolated from epidermal mucus of the flounder Platichthys stellatus pptx
... cells surrounding the vacuolated mucus-secreting cells of the gill (Fig 7B), principally within the epithelium of the primary lamellae and secondary lamellae The mucus-secreting cells stained positively ... circle The positions of the molecular mass markers are indicated inducing protein of Scomber japonicus (NCBI accession no CAC00499) A domain search showed that the gene detected in the gill of P ... SDS ⁄ PAGE Therefore, we performed PAGE in the presence of m urea (6 m urea ⁄ PAGE) to separate the antibacterial protein as remaining bioactivity Interestingly, the purified PSEM retained its bioactivity...
- 13
- 423
- 0
The Project Gutenberg EBook of Creating Capital, by Frederick L. Lipman pot
... earnings of the people of the United States The wealth of the nation consists mainly of the sum of the wealth of its citizens We are therefore told to seek increased earnings and to economize in ... headed in the right direction and he tends to reach the point of relative competence, of independence in his pecuniary affairs Preëminent in the class of the thrifty we think of the man of affairs; ... at the end of the fourth day is not the type of man who is going to spend the two holidays in pursuing higher aims in life; he is going to pass them in inaction, quite likely at the grog-shop The...
- 109
- 350
- 0
The Project Gutenberg E Book of Domestic Animals, by Richard L. Allen ppt
... according to an Act of Congress in the year 1847 By RICHARD L ALLEN, In the Clerk's Office of the District Court of the United States for the Southern District of New York INTRODUCTION The object ... colic flatulent colic inflammation of bowels physicking worms bots wind-galls the fetlock cutting sprain of the coffin-joint— ringbone enlargement of the hock 155 curb bone-spavin—swelled legs 168 ... weeds inflammation of the eyes stings of hornets, &c sprain bruises—fistula wounds—galls shoeing, contraction of the foot corns over-reach, forging or clicking 171 173 the bearing-rein the bit...
- 794
- 2,692
- 0
Báo cáo lâm nghiệp: "Soil environment and nutrient status of Norway spruce (Picea abies [L.] Karst.) underplantings in conditions of the 8th FAZ in the Hrubý Jeseník Mts" potx
... oxides in the last decades the impacts of air-pollution disaster are still obvious in the ridge parts of the CR mountain ranges A list of 19 research plots in the studied area with specification of ... content of this element in the humification horizon is low but sufficient, ranging from 120 to 250 mg·kg–1 Only in 15% of the plots it decreases below the limit of the lower optimum of 130 mg·kg–1 In the ... the subsequent organomineral horizon (Ae/Ep) the values of Ca indicate the lower optimum reserves in the range of 80–160 mg·kg–1, and in 15% of the studied plots the content of soil Ca decreases...
- 12
- 529
- 0
Báo cáo lâm nghiệp: "Influence of exogenous L-proline on embryogenic cultures of larch (Larix leptoeuropaea Dengler), sitka spruce (Picea sitchensis (Bong.) Carr.) and oak (Quercus robur L.) subjected to cold and salt stress" pdf
... samples of cells were analysed in triplicate The free proline concentration in the cells was determined using a modified ninhydrin method [3] 2.5 Statistical analysis Factorial analysis of variance ... significant effect of increasing NaCl concentration on the growth of embryogenic cultures (p < 0.0005) with NaCl causing a progressive decline in the growth rate and with complete inhibition of growth ... environmental stresses by manipulation of the accumulation of endogenous proline Recent studies show that introduction of a gene for the rate-limiting enzyme in proline biosynthesis has produced improved...
- 4
- 338
- 0
Báo cáo lâm nghiệp: " Influence of repeated defoliations by insects on wood increment in common oak (Quercus robur L)" pps
... Influence of the gypsy moth on the radial increment of the common oak Lesovedenie 2, 20-29 [in Russian] These Rubtsov VV, Rubtsova NN (1984) An Analysis of the Interactions between Leaf-eating Insects ... diversity of the sampling and data processing techniques used, the interpretations and conclusions from different authors diverge significantly The main aim of the present work was analyse the dynamics ... of annual wood-rings in oaks Wood cores were collected during autumn 1980 and 1990 from the northern and southern sides of the stems at 1.3 m The width of the 30 last annual rings was measured...
- 6
- 263
- 0
Báo cáo khoa học: "A comparison of photosynthetic responses to water stress in seedlings from 3 oak species: Quercus petraea (Matt) Liebl, Q rubra L and Q cerris L" doc
... obtained in all cases when wp ψ reached -3.5 MPa The decline of g was much steeper, reaching w -1 -2 values below 0.025 mol m s at -1.5 MPa in all species Differences in the decline rates of ... photochemical efficiency, the balance between the increase in thermal deexcitation and the reduction status of the pool of primary electron acceptors (Q ) A was similar in the species tested, and ... treatment (fig 5), which may be interpreted as the maintenance of the same equilibrium, at a given efficiency, between thermal deexcitation of PS II and the reduction status of the primary acceptor pool...
- 13
- 402
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008