iterative development of a decision aid

... preparation, the facilitation team will ask the village leaders in advance to form a group of ten participants that includes the village head, traditional village leader (gia làng), at least ... preparation, the facilitation team will ask the village leaders in advance to form a group of ten participants that includes at least women, better-off and poor households The facilitation team ... mechanism As such, great care was taken by the SNV consultation team in ensuring that the design and piloting stage was as inclusive of various stakeholders as was possible in the timeframe allocated...

Ngày tải lên: 09/01/2018, 10:05

... database of the most recent earthquakes recorded in in the territory of Vietnam and adjacent sea areas The database is regularly updated at the IGP (v) The “Earthquake Hazard” tab provides a ... for rapid assessment of realtime earthquakes (RARE), which can be used for calculating and displaying a shake map caused by a rea-time earthquake The hazard information taken from the shake map ... on-line database of earthquakes recorded from the national seismic network of Vietnam, and (2) a set of tools for rapid seismic hazard assessment Using an on-line earthquake database, the system allows...

Ngày tải lên: 14/10/2022, 11:39

... included approximately equal percentages of males and females, and the age range was from 18 to 65 years of age. Basically con- sumers are screened and recruited via internet and/or phone based on ... (2008) has also argued that concepts such as satisfaction are more appropriate than simple acceptance for commercial products, and that both brand and packaging need to be considered along with ... No clear classification Adventurous Active Angry Afraid Aggressive Blissful Affectionate Annoyed Alone Bewildered Comfortable Calm Bad Bored Craving Content Carefree Cruel Destroyed Critical Energetic...

Ngày tải lên: 03/04/2013, 21:07

... have information on what measures economies have Trang 4Management capabilities and approaches  APEC and the MRCWG have a role in liaising with IMO, FAO, NACA to enhance the effectiveness of ... Vector management is limited and unbalanced Trang 5Priorities and hazards for Economies  Variable levels of activity and management capability Ships’ ballast water and hull fouling are the ... Trang 1Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine PestsAustralia and Chile Mr Philip Burgess, Dr Alex...

Ngày tải lên: 28/10/2013, 11:15

... primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ ... further analysis of the molecular and cellular phenotypes of endothelial cells and their heterogeneity at various developmental stages, in vascular beds and in various organs has often been hampered ... Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko...

Ngày tải lên: 18/02/2014, 17:20

... AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT ... (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-GCATGCCTGCAGG TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT CCC-3¢), and checked for the presence and sequence of the new ... CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT GACCGCCTCCC-3¢); for Golf (5¢-GGTACCGCTGCAA TGGGGTGTTTGGGCAAC-3¢) and (5¢-GCGGCCGCCT CAGATCACAAGAGTTCGTACTGC-3¢); for Ga15 (5¢-AT GGCCCGGTCCCTGACTTGG-3¢) and (5¢-TCACAGCA...

Ngày tải lên: 07/03/2014, 16:20

... simulations 4.1 The graphic user interface of the package The package is designed with a main interface that allows users to input topographical elevation data of the top (upper) surface of any ... topographic data and the generated meshes The package has been applied to the generation of 3D computational meshes used as the input of a computational fluid dynamics model for simulations of turbulent ... inverse mapping between the 3D real computational domain and a rectangular domain in the parametric space [1, 2, 5, 6] For short, the formulae for Y and Z coordinates are the same and they are not...

Ngày tải lên: 14/03/2014, 13:20

... ABA had a higher OH • level after ParA1 treatment. H 2 O, H 2 O pretreatment; H + ParA1, ParA1 infiltration after H 2 O treatment; A4 00, 400 lM ABA pretreatment; A + ParA1, ParA1 infiltration after ... plus adenine), PT (ParA1 plus thiourea), PV (ParA1 plus ascorbic acid) and PC (ParA1 plus catalase) were infiltrated into the same leaves of tobacco plants, which had been sprayed with 100 lm ABA, ... Switzerland). Catalase, SOD, ascorbic acid and ABA were purchased from Sigma (St Louis, MO, USA). All other mentioned reagents were of analytical grade. Plant culture condition Tobacco plants (N. tabacum...

Ngày tải lên: 15/03/2014, 00:20

... extraction procedure for SPM-associated trace metals, using a ligand competition approach with EDTA as the added complexing ligand. The use of EDTA allows the determination of available particulate ... been explained by an increase in major cation concentrations. Suspended particulate matter may consist of biological, organic and mineral phases [5] and each of these phases has a different af®nity ... using a HDPE scrap- per. Air was expelled and the bag was resealed and then stored at 48C for transport to the laboratory. In the laboratory, the particulate material was immediately air dried at...

Ngày tải lên: 15/03/2014, 23:56

... list of suffixes. Where stems are used as a means of associating re- lated items of information, as they are in an automated library catalogue, and where the catalogue can be in- terrogated ... of Chicago, Department of Lin- guistics. variety of applications are considered in evaluating the theoretical and practical attributes of several previous algorithms. As a major part of its ... sonal communication]) or mathematical analysis of a body of language, often require matched stems. (So does stemming as part of an information-retrieval sys- tem, the specific application...

Ngày tải lên: 16/03/2014, 19:20

... Miyako Kitamura1, Tatsuya Tsuda2, Kiyofumi Yamanishi2, Masatoshi Maki1 and Kiyotaka Hitomi1 Department of Applied Molecular Biosciences, Graduate School of Bioagricultural Sciences, Nagoya University, ... – 2A – 1A QN + 1A + 2A + 3A + 4A + 5A + 6A + 7A + 8A + 9A Fig Assessment of the contribution of each amino acid residue of K5 to substrate recognition Alanine substitution mutants of K5 were produced as ... M, Yamashita F, Ishida-Yamamoto A, Yamada K, Kinoshita C, Fushiki S, Ueda E, Morishima Y, Tabata K, Yasuno H et al (1998) Defective stratum corneum and early neonatal death in mice lacking the...

Ngày tải lên: 23/03/2014, 06:20

... toán đợc trình bày qua sơ đồ số một, giai đoạn thực kế hoạch kiểm toán đợc thực sau giai đoạn lập kế hoạch kiểm toán trớc giai đoạn giai đoạn hoàn tất kiểm toán Về thời gian giai đoạn thực kế hoạch ... viên Bớc thứ hai, đánh giá ban đầu rủi ro kiểm soát lập kế hoạch kiểm toán cho khoản mục *Đánh giá ban đầu rủi ro kiểm soát: việc đánh giá khả phát hiện, ngăn ng a s a ch a kịp thời sai phạm trọng ... kiểm tra chi tiết Hiện nay, khái niệm chung kiểm tra chi tiết sử dụng cho kiểm toán tài quốc gia khác cha thống Tuỳ theo mục đích khác nghiên cứu, thực hành mà có khái niệm khác Sau số quan điểm...

Ngày tải lên: 16/08/2012, 16:17

... Việt Nam 2.4 Các công ty liên doanh nớc -V-TRACO Co, Metropo Sofitel Hotel, Mitsubishi, Unilever, Cargil, Kao, BP, Cocacola, Caterpilar-VTRA, Ford, Jica, ABB, Convik Iternational, crow agents, ... Bank of Tokyo, Sumitomo bank, Standard_characterbank, ABN-amro bank 2.3 Các công ty sản xuất dịch vụ -Công ty Phốt phát Lâm Thao, Phân đạm Hà Bắc -VietsoPetro, Vietnam airlines, công ty nớc Hà ... doanh: Nông nghiệp, Đầu t, Công thơng, Ngoại thơng -Cổ phần: Hàng hải, Thơng mại Xuất nhập khẩu, châu -Nớc ngoài: Indonesia, VID_Public bank, May bank, ANZ bank, ING bank, Indovina, Bank of...

Ngày tải lên: 31/08/2012, 15:40

... thành Hai nguyên tắc tham gia: Nguyên tắc tham gia có liên quan mật thiết đến nguyên tắc thống Nguyên tắc có ngh a thành viên doanh nghiệp tham gia hoạt động cụ thể công tác kế hoạch h a, không ... lao động Người lao động tham gia vào kế hoạch chung toàn doanh nghiệp th a mãn nhu cầu riêng thân họ - Sử dụng nguyên tắc tham gia cho phép người trực tiếp tham gia vào công việc kế hoạch h a ... mại nước tham gia hội nghị doanh nghiệp thương mai giới thơì gian hội nghị WTO tổ chức Việt Nam, tham gia hội thảo, diễn đàn VCCI, phòng thương mai châu Âu, Hội Việt MỸ …tổ chức, tham gia đoàn xúc...

Ngày tải lên: 08/09/2012, 13:33

... thanh, s a ch a 11 đờng ngang, s a ch a lắp đặt 5.000m hàng rào, bổ sung đá lẻ tẻ dọc tuyến - S a ch a gia cố cầu xung yếu: gồm gia cố dầm, s a ch a chống xói lở mố trụ; - S a ch a đờng giao ... s a ch a thờng xuyên định kỳ, kế hoạch s a ch a khẩn cấp kế hoạch s a ch a lớn 2.1.2.2 .a K hoch sa cha thng xuyờn nh k Nhim v ch yu ca k hoch sa cha thng xuyờn nh k l thc hin thay mi, sa cha cú ... ga Hà Nội; - S a ch a hệ thống tín hiệu đờng ngang có gác 52 hệ, S a ch a dờng ngang cảnh báo tự động 27 Đà Nẵng, S a ch a cắt sét cho đờng ngang 37 hệ, tổng đài Quy Nhơn, S a ch a cột vi ba...

Ngày tải lên: 08/09/2012, 13:39

... ghi nhận doanh thu với giao dịch sau: Theo thông báo số 99-17 EITF “Accounting for Advertising Barter Transactions” (EITF 99-17), giá trị hợp lý quảng cáo đem trao đổi xác định trước doanh nghiệp ... danh mục tra cứu Yahoo! phí khoảng 299$/năm, VietnamTradeFair.com phí 200.000VNĐ/1 lần đăng ký mãi 1.3.2.3 Quảng cáo tài trợ trang tìm kiếm: Hiện có công cụ tìm kiếm lớn như: Google, Yahoo! hay ... hàng h a tương đương thị trường Mặt khác, giá trị QC trang web khác khác nhau, điều kiện ch a có tổ chức đủ uy tín đ a chuẩn chung để lượng giá trang web, giá trị QC trang web so sánh với hay nói...

Ngày tải lên: 13/09/2012, 14:44

... trước, cha ông ta để lại đất Phù Cừ 45 ch a thờ phật đậu thờ vùng.Trong số 45 chù có Đậu thờ lớn : Đậu thờ T a ( xã Trần Cao ), Đậu Trà Bồ ( xã Phan Sào Nam ), Đậu Tam a (xã Tam a ), Đậu Quang Xá ... Sào Nam quan Minh Tân sang Quang Hưng chạy dọc theo sườn đông huyện đến Tam a, dài 10 km.Sông Kẻ Sặt đường ranh giới tự nhiên Phù Cừ huyện Thanh Miện Tỉnh Hải Dương Dọc theo sườn ph a Nam huyện ... thống lâu đời cha ông ta vùng đồng châu thổ sông Hồng, đ a hình nhìn chung phẳng, thấp dần từ tây sang đông, từ ph a bắc xuống ph a nam, đồi núi, song độ cao trung bình thấp dao động từ +1,4...

Ngày tải lên: 02/10/2012, 15:48

... Khoa: Kế hoạch phát triển Hệ thống theo dõi, đánh giá sở để biết tiến độ thực kế hoạch, cách để biết ta đâu, liệu ta hướng hay ch a, ta cách đích bao xa, liệu ta đến đích hay không Điều có ngh a ... nghiệm quan trọng hơn, đạt tính hiệu chọn sai mục tiêu Hai tiêu chuẩn nói song hành với hai kh a cạnh kế hoạch h a: Xác định mục tiêu “đúng” chọn l a biện pháp “đúng” để đạt mục tiêu Cả hai kh a cạnh ... ngh a “Kế hoạch h a doanh nghiệp qui trình định cho phép xây dựng hình ảnh mong muốn trạng thái tương lai doanh nghiệp trình tổ chức triển khai thực mong muốn đó” 1.2 Vai trò kế hoạch h a doanh...

Ngày tải lên: 05/10/2012, 16:41

... toán doanh nghiệp mà với quan quản lý quan hữu quan khác (cơ quan thuế, quan chủ quản, quan tra,cơ quan kiểm toán) việc kiểm tra, kiểm soát, giám sát hoạt động sản xuất, kinh doanh doanh nghiệp ... vào trang sổ hay thẻ Có thể có nhiều trang sổ hay thẻ sử dụng để lưu trữ tất nghiệp vụ kinh tế phát sinh đơn vò kế toán theo thứ tự thời gian Sắp xếp trang sổ hay thẻ lại với thành sổ Các trang ... toán doanh nghiệp Việt Nam tạm chia thành giai đoạn sau: 2.1.1.Giai đoạn từ năm 1954 đến năm 1986 Sau giành độc lập (1945) năm đầu kháng chiến chống Pháp (1945 – 1954), kế toán nước ta đơn việc...

Ngày tải lên: 13/10/2012, 17:07