... picture of an American woman in the late 1920s Doreen Sulivan, a beautiful woman from Philadelphia, had an appearance which was a fashion of the day with a thin, sleeveless dress over a light camisole, ... United States Barack Obama who has made a history in American presidency to be the first black to hold the office African American have gained recognizable stand in American society that they ... leading in their big mansions… Smoking jackets and cravats, spats and canes, elegant garden parties and martinis… This was a world of so elegantly distant from ours, it was like a voyage to another...
... friction at the wall against Kp for different values of magnetic parameter M and heat source parameter S are entered in Tables and respectively From Table 1, we observe that a growing magnetic parameter ... m7 = A6 = − A5 + A4 + A3 , A7 = A1 0 = A7 − A8 + A9 , B1 = A1 m5 (m3 − m5 )(m4 + m5 ) , A8 = A1 m1 (m3 − m1 )(m4 + m1 ) , A9 = A2 m7 (m3 − m7 )(m4 + m7 ) , 2 A1 A3 Pr G r A1 A5 Pr G r − A1 A4 Pr ... field are magnetic parameter M, permeability parameter Kp, Grashof number for heat transfer Gr and heat source parameter S The effects of these parameters on the velocity field have been analyzed...
... N-Pro 208 aa 34 aa CT - ex Stop 114 aa Xho1 365 aa 24 aa 208 aa N-Pro N Pro II 24 aa Protease domain BamH H1 Start I 114 aa Pre A S Dutta et al Protease domain CT - ex 34 aa III 208 aa N-Pro NP ... latex of Ervatamia coronaria Biosci Biotechnol Biochem 62, 1947–1955 15 GuhaThakurta P, Biswas S, Chakrabarti C, Sundd M, Jagannadham MV & Dattagupta JK (2004) Structural basis of the unusual ... (isolated from the latex of Ervatamia coronaria in our laboratory) and papain from Carica papaya (Merck, Kenilworth, NJ, USA)], two serine proteases [trypsin and chymotrypsin from bovine pancreas...
... self-regulation; that is, an organization maintains a quasi-steady state through homeostatic mechanisms that involve information feedback This analogy may be taken too far: a hospital is not a biological ... diagnose and treat ambulatory as well as bed-bound patients, and outpatient treatment gradually came to account for a large proportion of hospital activity Also, the middle classes began to attend, changing ... Europe Age-standardized death rate from cancer of the lung, bronchus and trachea per 100,000 population in Finland and Portugal, all ages, 1970–98 Age-standardized death rate from cerebrovascular...
... a department has a selection standard that results in the rejection of a greater percentage of women than men, or a greater percentage of African Americans than whites, an “adverse impact” has ... standards for research quality and objectivity Police Personnel Challenges After September 11 Anticipating Expanded Duties and aChanging Labor Pool Barbara Raymond, Laura J Hickman, Laura Miller, Jennifer ... relevant variables faced by the wide variety of small and large police departments across the nation While many issues are shared, there are also many aspects unique to each department Each agency...
... ubiquitination is unlikely to be related to a defective membrane interaction While being persistently activated and associated with plasma membrane, Rac1b has an impaired ability to activate several ... that the stimulation of Rac1-dependent pathways may, in some way, activate the Rac1 ubiquitination machinery As Rac1b has been shown to display reduced capacity to bind POSH [28] and to activate ... ligase Itch Science 306, 271–275 40 Tapon N, Nagata K, Lamarche N & Hall A (1998) A new rac target POSH is an SH3-containing scaffold protein involved in the JNK and NF-kappaB signalling pathways...
... concepts through courses in Marketing Management, Organizational Behavior, Strategic Management, Accounting and Management Control, Financial Management, Managerial Economics, Operations and Supply ... programs in undergraduate, graduate, and medical education are characterized by a distinctive academic philosophy, a world-class faculty, and a tradition of innovative and rigorous multidisciplinary ... School is fully accredited by the three leading accreditation agencies in the management education arena: AACSB, EQUIS and AMBA, guaranteeing the quality and academic rigor of our programs IE Business...
... 689–697 26 Matsufuji, S., Miyazaki, Y., Kanamoto, R., Kameji, T., Murakami, Y., Baby, T.G., Fujita, K., Ohno, T & Hayashi, S (1990) Analyses of ornithine decarboxylase antizyme mRNA with a cDNA cloned ... cDNA encoding mammalian ornithine decarboxylase Proc Natl Acad Sci USA 81, 3645–3649 30 Graham, F.L & van der Eb, A. J (1973) A new technique for the assay of infectivity of human adenovirus DNA ... antizyme is a rapidly degraded protein and that as with ODC, the degradation of antizyme is also carried out by the proteasome Antizyme mRNA contains two variably used in-frame initiation codons...
... replaced, and littering xi playing through golf cart abuse Walking car ts and riding car ts are great conveniences and can save your back, but they also can wreak havoc on other people’s golf games ... appreciate the beauty of the places that, as golfers, we get to enjoy I was having a particularly bad day on a course in Pagosa Springs, Colorado After yet another lousy shot, my cart mate came over, ... putting and hand them to us This made the round easy and very pleasant I have an electric handcart One day I hadn’t charged the battery fully and it ran out of juice As I was pushing it back to...
... process takes place Indeed, although Rac activation is believed to occur primarily at the plasma membrane, BAF60b ubiquitination is controlled by Rac and Unkempt BAF60b, as well as BAF6 0a and BAF60c, ... cellular mRNA levels were monitored by RT-PCR (Access RT-PCR system; Promega, Madison, WI, USA) using Unkempt-specific primers 5¢TCTTCGAGTG CAAGTCCAAA and 5¢AAGATCACCTGTGCCTCCAC, and normalized against ... Tsuchiya A, Kiyono M, Nosaka T et al (2006) Rac1 and a GTPaseactivating protein, MgcRacGAP, are required for nuclear translocation of STAT transcription factors J Cell Biol 175, 937–946 26 Michaelson...
... proteasomal degradation or stabilization of the transcription factor HIF- 1a AKAP signaling AKAP-Lbc signaling complex AKAP-Lbc is another multivalent anchoring protein that organizes PKA and PKC ... proteins (AKAP150, mAKAP and AKAP-Lbc) and their interacting partners are discussed in detail (Table 1) AKAP79/150 signaling complexes To date, AKAP150 (the murine homolog of human AKAP79) remains ... classic enzyme feedback loop because anchored PKA activity eventually leads to the termination of cAMP signals Interestingly, the same AKAP A B C D Fig mAKAP signaling complexes (A) mAKAP assembles...
... 5¢-AGACAGCCGTTTTACACGCAG-3¢; P2 antisense, 5¢-CACCGAGAAATCGAAATCACC-3¢; P3 sense, 5¢-TAGGAAGGTTGTATCGCGGAGG-3¢; and P3 antisense, 5¢-CAAGGAAGGAGGACTGGGCTC-3¢ [28] The locations of P1, P2 and P3 at the p16 ... isothiocyanate-conjugated goat anti-(rabbit serum) as secondary antibody, incubated with rat anti-3MeK9H3 serum and stained with TRITCconjugated goat anti-(rat serum) as secondary antibody, and finally ... data The target RNAi sequence for ZBP-89 was 5¢-GAGCAGAAGCAGGTG CAGA-3¢ [29] The p16-targeting siRNA sequence was 5¢-GAGGAGGTGCGGGCGCTGC-3¢ [18] An oligonucleotide that represents the small hairpin...
... Information Retrieval ACM Press / Addison-Wesley Scott C Deerwester, Susan T Dumais, Thomas K Landauer, George W Furnas, and Richard A Harshman 1990 Indexing by latent semantic analysis JASIS, ... sort of machine learning, using a small manually annotated collection of texts When optimized -parameters are used, the Local Search procedure tries to simulate the behavior of human annotator who ... clustering allows for some ambiguity in the data, and its main advantage over hard clustering is that it yields much more detailed information on the structure of the data (cf (Kaufman and Rousseeuw,...
... food, clean air, affordable child care, accessible and affordable recreation services, and access to high quality health care 23 Bierman et al, ‘Social Determinants of Health and Populations at Risk’, ... health is far higher for marginalized populations Health inequities – differences in health outcomes that are avoidable, unfair, and systematically related to social inequality and disadvantage ... Determinants of Health and Populations at Risk’, p 29 29 Bierman et al, ‘Social Determinants of Health and Populations at Risk’, p 29 30 Raine, Overweight and Obese in Canada: A Population Health...
... United Kingdom Italy France China Australia Japan Russian Federation Canada Brazil Germany Turkey South Korea India South Africa Indonesia Mexico Argentina G20 countries' total 2010b) 72.8 41.4 ... losses a) Based on banks contained in respective countries' Datastream bank indices Note that such data are not available for Saudi Arabia b) From 1-Jan-10 to 29-Jul-10 c) Based on banks contained ... investment alternatives, percentage changes over period, annualised, in US dollar terms ‐80% EQUITIES: INDIA‐DS Market LATIN AMERICA‐DS Market EMERGING MARKETS‐DS Market ASIA EX JAPAN‐DS Market CHINA‐DS MARKET $...
... offices and databases that could support ocean acidification observational and research data The FOARAM Act also calls for an “Ocean Acidification Information Exchange” that would go beyond chemical ... climate service and marine ecosystem management programs to develop a broad strategy for decision support DATA MANAGEMENT Data quality and access, as well as appropriate standards for data reporting ... Seasonal aragonite undersaturation in surface waters has already been observed in the Canada Basin of the Arctic Ocean (Bates et al., 2009; Yamamoto-Kawai et al., 2009) Persistent undersaturation...
... place at several times the natural replacement rate, the amount of available arable land per person has dropped substantially and agricultural productivity has slowed At the same time an area ... countries: Australia, Brazil, Canada, China, Denmark, France, Germany, India, Ireland, Italy, Japan, Mexico, Netherlands, Russia, Singapore, South Africa, South Korea, Spain, Sweden, Switzerland, the ... generate insights such as: • Demand and supply stresses are likely to be concentrated in areas such as China and India that already experience massive challenges of water availability and agricultural...
... Biotechnology, Santa Cruz, CA, USA); cleaved caspase-3, rabbit polyclonal anti-cleaved caspase-3 (Asp175) (#9661; Cell Signaling Technology, Danvers, MA, USA); caspase-9, rabbit polyclonal anti-caspase-9 ... Yasuda K, Nakai A, Hatayama T & Nagata K (1995) Cloning and expression of murine high molecular mass heat shock proteins, HSP105 J Biol Chem 270, 29718– 29723 Ishihara K, Yasuda K & Hatayama ... of caspase-3 mediated by heat shock In mammalian cells, one of the main pathways that activates procaspase-3 is via mitochondria When the mitochondria receive appropriate signals from a variety...