intractable epilepsy in the setting of malformations of cortical development as a mechanism for sud ep
báo cáo khoa học: " Recurrent takotsubo cardiomyopathy in the setting of transient neurological symptoms: a case report" pptx
... the development of TTC in the setting of fleeting neurological symptoms such as aphasia and ataxia without structural brain disease has never been reported Histological and nuclear imaging data ... 226/100 mmHg) Her aphasia was isolated and transient, and her physical examination was otherwise unremarkable Because we were concerned about an acute intracerebral event in the setting of hypertensive ... pathology, including subarachnoid hemorrhage and congenital brain abnormalities in children In the setting of intracranial injury or dysfunction, such as the catecholamine toxicity described in...
- 4
- 357
- 0
Báo cáo y học: "Commonly applied positive end-expiratory pressures do not prevent functional residual capacity decline in the setting of intra-abdominal hypertension: a pig model" pot
... bacterial translocation J Trauma 2002, 52:13-17 Kitano Y, Takata M, Sasaki N, Zhang Q, Yamamoto S, Miyasaka K: Influence of increased abdominal pressure on steady-state cardiac performance J Appl ... If increased levels of PEEP are indicated in the clinical setting, it might be prudent to assess CO and arterial oxygen saturation before and after increasing the level of PEEP in order to ascertain ... IAH PEEP did not increase PaO2 values in IAH The minimal PaO2 decrease as compared to the relatively larger FRC decrease in the setting of raised IAP can be explained by the FRC not dropping below...
- 11
- 406
- 0
Starting ARVs in the setting of Opportunistic Infections pptx
... NVP containing ARV Weerawat M et al CID 2006;43:253-5 Guidelines for Diagnosis and Treatment of HIV/AIDS, Ministry of Health, Vietnam March, 2005 16 Starting ARVs in the setting of an active Opportunistic ... ADI and death! Since most ADI started at minimum month, ideally to start as soon as patient tolerates TB therapy and has a good response….may be after weeks Dean et al AIDS 2002:16(1):75-83 Dean ... TB in Vietnam • Cite the recommendation of the MOH of the use of NVP with a RIF containing TB therapy • Cite the best time and clinical conditions that a patient with a treated OI can be started...
- 40
- 384
- 0
Báo cáo khoa học: "Atypical presentation of angiosarcoma of the scalp in the setting of Human Immunodeficiency Virus (HIV)" pdf
... search and drafted the manuscript The author has read and approved the final manuscript References 10 Holloway CL, Turner AR, Dundas GS: Cutaneous angiosarcoma of the scalp: A case report of ... the occipital scalp mass demonstrated an epithelioid angiosarcoma She also had a biopsy of a cervical lymph node which demonstrated features of a metastatic epithelioid angiosarcoma HIV Elisa ... approach comprising both surgery and radiotherapy Wide field radiotherapy appears to be a rational therapeutic choice for scalp angiosarcoma because the involved dermis as well as a sufficient area...
- 4
- 242
- 0
Báo cáo khoa học: "Diagnosis of left ventricular diastolic dysfunction in the setting of acute changes in loading conditions" pdf
... velocity of LV inflow at early diastole (Vp) was measured as the slope of the first aliasing velocity during early filling, from the mitral valve plane to cm distally into the LV cavity [21] LV diastolic ... or in the transgastric longitudinal view (around 120°) with multiplane TEE Cardiac index was obtained by measuring the velocity-time integral of aortic Doppler tracings and the diameter of the ... whereas transoesophageal echocardiography (TEE) was used in ventilated ICU patients The echocardiographic study was performed before (baseline) and at least one hour after haemodialysis using a...
- 9
- 255
- 0
Tài liệu ISSUES IN THE INTEGRATION OF RESEARCH AND OPERATIONAL SATELLITE SYSTEMS FOR CLIMATE RESEARCH pdf
... observations as indicators of regional- to basin-scale change, as well as for forecasting stress on the natural flora and faunal assemblages The National Polar-orbiting Operational Environmental Satellite ... of the National Academy of Sciences The National Academy of Engineering was established in 1964, under the charter of the National Academy of Sciences, as a parallel organization of outstanding ... program of data analysis and data product validation by NASA’s Earth Science Enterprise (ESE), and an active plan for NASA and NOAA collaborative missions such as the NPOESS Preparatory Project The...
- 153
- 605
- 0
Impact of chronic disease on quality of life among the elderly in the state of São Paulo, Brazil: a population-based study pptx
... of Medical Sciences of the State University of Campinas, Campinas, São Paulo RESULTS The data analyzed came from a total of 958 individuals—929 males and 029 females 60 years of age or more The ... enfermedades crónicas o más La presencia de cualquiera de las siete enfermedades crónicas estudiadas influyó significativamente en la puntuación de casi todas las escalas de la SF36® La HRQOL alcanzó ... Secretary of Health for financing the fieldwork; to the Secretary of Health Surveillance of the Ministry of Health for financial support in the data analysis through the Health Analysis Collaborative...
- 8
- 701
- 0
ENVIRONMENTAL INDICATORS: A SYSTEMATIC APPROACH TO MEASURING AND REPORTING ON ENVIRONMENTAL POLICY PERFORMANCE IN THE CONTEXT OF SUSTAINABLE DEVELOPMENT pot
... sustainability in the weak sense means that the value of savings must at least equal the depreciation of manufactured capital less the depletion of natural capital, so that society's total capital ... similar.) The approach has been applied in an illustrative way to calculate an overall index for Costa Rica over a period of years Other approaches to measuring sustainability based on natural resource ... sustainable if their use leads to the creation of other assets of equal value In the language of the economics of sustainable development, this is an assumption that natural resource assets can...
- 58
- 698
- 0
Selective Distribution of Luxury Goods in the Age of e-commerce An Economic Report for CHANEL doc
... that of an integrated structure arises because the margin of an independent retailer is lower than the margin of an integrated structure This can come about either because the marginal wholesale ... Because it includes this margin, the “marginal cost” which the independent retailer faces is higher than the marginal cost that an integrated manufacturer/retailer would face As a result the final price ... product, and therefore achieve higher value for the buyer, the greater the retailer effort Again, a retailer will not capture the full value of increasing the likelihood of a sale, leading to too...
- 33
- 1,047
- 0
Báo cáo y học: "Role of Leukotriene Receptor Antagonists in the Treatment of Exercise-Induced Bronchoconstriction: A Review" pot
... the management of asthma Ann Pharmacother 1999;33:1299–314 National Heart, Lung, and Blood Institute, National Asthma Education Program Guidelines for the diagnosis and management of asthma Expert ... methacholine, allergens, and cold air.7 In aspirinsensitive individuals, LTRAs inhibit the response to acetylsalicylic acid challenge and improve asthma control.7 LTRAs may also have a role as ... However, they are not as effective as inhaled 2 agonists are in the management of EIB.12 Other Agents Anticholinergics, antihistamines, ␣ agonists, and oral 2 agonists have also been investigated for...
- 5
- 663
- 0
Báo cáo y học: "The opposite effects of fluvoxamine and sertraline in the treatment of psychotic major depression: a case report" potx
... fluvoxamine (150 mg) monotherapy was maintained, and her condition remained good At years after the disappearance of the delusions, the patient began overeating and oversleeping, as well as experiencing ... Ishikawa M, Ishiwata K, Ishii K, Kimura Y, Sakata M, Naganawa M, Oda K, Miyatake R, Fujisaki M, Shimizu E, Shirayama Y, Iyo M, Hashimoto K: High occupancy of sigma-1 receptors in the human brain after ... receptors play a role in the pathophysiology of major depression and in the active mechanisms of some antidepressants [16-20] The inhibition constants (Ki) of fluvoxamine and sertraline at sigma-1...
- 3
- 401
- 0
Báo cáo khoa học: " Intensity modulated radiotherapy (IMRT) in the treatment of children and Adolescents - a single institution''''s experience and a review of the literature" pps
... Laskar S, Bahl G, Muckaden M, Pai SK, Gupta T, Banavali S, Arora B, Sharma D, Kurkure PA, Ramadwar M, Viswanathan S, Rangarajan V, Qureshi S, Deshpande DD, Shrivastava SK, Dinshaw KA: Nasopharyngeal ... years ago as part of multimodality treatment of an acute lymphoblastic leukaemia About four years later he presented with an anaplastic astrocytoma and therefore received external beam radiation ... chances of cure the patients accepting possible risks in a matter of decades in case of success IMRT was feasible even if anaesthesia was necessary and resulted in good local control rates for...
- 10
- 523
- 0
báo cáo khoa học: " Using the theory of planned behaviour as a process evaluation tool in randomised trials of knowledge translation strategies: A case study from UK primary care" pot
... was calculated as the mean of all items contributing to the construct Cronbach’s alpha was used to ascertain the reliability of each of the scales If reliability was lower than 0.7, an exploratory ... assessment of menopausal status, and the measurement of Helicobacter Pylori serology (HPS) following eradication therapy Therefore, the aim of the study was to undertake a theory-based process evaluation ... between intention and behaviour, because the behaviour data were at a practice level, a summary measure of intention for each practice had to be calculated This was generated in two ways – by taking...
- 9
- 367
- 0
Báo cáo y học: "The effectiveness of manual stretching in the treatment of plantar heel pain: a systematic review" pot
... on Pain localised at palpation of plantar initial the plantar heel fascia origin weightbearing Pain at worst on Diagnosis of plantar Pain localised at initial weightfasciitis by a Physician the ... diagnosis of plantar heel pain/fasciitis, or fulfill at least two of the following criteria: pain localised to the plantar tissues, localised pain on palpation of the plantar tissues, plantar ... joined participants from the plantar fascia stretching group in carrying out plantar fascia stretches for a further two years Although an improvement in pain relief continued, the absence of a...
- 13
- 460
- 0
Báo cáo y học: " Isolated radial head dislocation, a rare and easily missed injury in the presence of major distracting injuries: a case report" ppsx
... as the main author RSUY was involved in reviewing the literature and proof reading of the manuscript RSUY has approved the final manuscript SSB is the senior author and was responsible for final ... dislocated radial head Figure Radiograph of the elbow showing a dislocated radial head Radiograph of the elbow showing a dislocated radial head to the forearm [3] although Bonatus et al speculated ... L, Huot D, Lepage D, et al.: Isolated traumatic luxation of the radial head in adults: report of a case and review of literature Chir Main 2003, 22(4):216-9 Takami H, Takahashi S, Ando M: Irreducible...
- 3
- 373
- 0
Báo cáo khoa hoc:" Combined use of maxillomandibular swing approach and neurosurgical ultrasonic aspirator in the management of extensive clival chordoma: A case report" pptx
... worsening right-sided nasal blockage of one year duration, with two episodes of epistaxis and deterioration of vision On examination there was a mass in the right nasal cavity extending across the ... without injury of the structures within the dural space i.e brainstem, basilar Figure Sagittal and axial views of brain MRI scan Sagittal and axial views of brain MRI scan Image shows tumour in the ... utilizing rectus abdominus muscle First a left maxillary swing approach via a WeberFergusson-Longmire incision was performed The maxilla was swung laterally based on a cheek flap As the access to the...
- 4
- 456
- 0
Báo cáo y học: "Low-concentration, continuous brachial plexus block in the management of Purple Glove Syndrome: a case report" pps
... Physiology and local anesthesia action in Neural Blockade in Clinical Anaesthesia and management of pain In Neural Blockade in Clinical Anesthesia and Management of Pain 3rd edition Edited by: Cousins ... irritation such as pain, oedema and erythema warrants immediate discontinuation of the infusion and removal of the intravenous catheter [1] The diagnosis of PGS is based on the characteristic clinical ... to the infusion [7] Women and the elderly are said to have an increased risk of PGS Other factors associated with it include peripheral vascular disease and diseases that weaken the vascular and...
- 4
- 340
- 1
Báo cáo y học: "Unusual presentation of cactus spines in the flank of an elderly man: a case report" pdf
... interpreted the patient data regarding the foreign body of the skin The manuscript was written by AS and critically evaluated by SF, LP, and RD All authors read and approved the final manuscript Acknowledgements ... granuloma formation [1,2] Patients may not be aware of the initial injury and at times, deeply penetrating splinters cannot be visualized In these cases, unfortunately, the only indication of ... Ahmad TS, Abdullah BJ: Splinter removal with the aid of ultrasonography: a case report Malaysian Orthopaedic Journal 2008, 2:47-49 Bouajina E, Harzallah L, Ghannouchi M, Hamdi I, Rammeh N, Hamida...
- 4
- 327
- 0
Báo cáo y học: " Comparison of the efficacy of lamivudine and telbivudine in the treatment of chronic hepatitis B: a systematic review" pdf
... Quality assessment Quality of the trials was assessed using the QUOROM guidelines as well as using the Jadad scale[12] Data analysis Data analysis was carried out with the use of Review Manager Software ... varies greatly in different parts of the world Based on the prevalence of HBV surface antigen(HBsAg) carrier rate in the general population, sub-Saharan African, East Asian and Alaskan populations ... WANFANG database (from 1990 to April 2010), the Cochrane Central Register of Controlled Trials and the Cochrane Database of Systematic Review Of these databases, CNKI, WANFANG and VIP databases provide...
- 11
- 398
- 0
Báo cáo y học: "The efficacy of Link N as a mediator of repair in a rabbit model of intervertebral disc degeneration" ppt
... 3’) Aggrecan Forward: GAGGTCGTGGTGAAAGGTGT Annealing temperature (°C) 60 Reverse: GTGTGGATGGGGTACCTGAC COL 1A1 Forward: AGGGCCAAGACGAAGACATC 62 Reverse: AGATCACGTCATCGCACAACA RNA extraction and ... performed the biochemical analysis and statistical analysis, and was involved in preparation of the manuscript RP, TY and AH performed data acquisition and statistical analysis PJR participated in the ... CCTGGCAGGTGAGTTTGCAT ADAMTS- Forward: CCTGGCAGGTGAGTTTGCAT 60 Reverse: GGAGAACATATGGTCCCAACGT GAPDH Forward: ACTCTGGCAAAGTGGATG 60 Reverse: TCCTGGAAGATGGTGATG expression of the Link N-treated...
- 9
- 402
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25