intracellular signaling network as a prime chemotherapy target of green tea catechin epigallocatechin 3 gallate
báo cáo hóa học:" Aberrant expression and potency as a cancer immunotherapy target of alpha-methylacyl-coenzyme A racemase in prostate cancer" pptx
... survivin Clin Cancer Res 2002, 8:1 731 -1 739 Hariu H, Hirohashi Y, Torigoe T, Asanuma H, Hariu M, Tamura Y, Aketa K, Nabeta C, Nakanishi K, Kamiguchi K, Mano Y, Kitamura H, Kobayashi J, Tsukahara T, Shijubo ... expression of β-actin mRNA and AMACR mRNA in prostate cancer line LNCaP, but only very weak expression of AMACR mRNA was observed in normal adult liver and pancreas (Figure 1A) In contrast, the AMACR ... Clontech, Palo Alto, CA) were used as a template of normal tissue cDNA Total RNA was extracted using an RNeasy kit (Qiagen, Hilden, Germany) A cDNA mixture was synthesized from μg of total RNA by reverse...
- 11
- 531
- 0
Báo cáo y học: " siRNA screen of the human signaling proteome identifies the PtdIns(3,4,5)P3-mTOR signaling pathway as a primary regulator of transferrin uptak" docx
... Domains (CDD) databases (Figure 2a; Additional data file 2) Components of canonical signaling pathways were included (for example, Ca2+, cAMP, and ERK), as well as less characterized and putative ... directly estimated from the relevant data set with no need to assay in parallel a large population of identical d-siRNAs For each average F score from each d-siRNA, the calculated CAsH parameter then ... (b) Quantification of the effects of different siRNAs targeting the PtdIns (3, 4,5)P3-mTOR pathway and rapamycin (RAPA) on transferrin uptake Means ± standard error of the mean (SEM; for d-siRNAs,...
- 11
- 286
- 0
Tài liệu Báo cáo khoa học: Mammalian mitotic centromere-associated kinesin (MCAK) A new molecular target of sulfoquinovosylacylglycerols novel antitumor and immunosuppressive agents pptx
... fragrans J Nat Prod 60, 38 7 38 9 Sahara H, Hanashima S, Yamazaki T, Takahashi S, Sugawara F, Ohtani S, Ishikawa M, Mizushina Y, Ohta K, Shimozawa K, et al (2002) Anti-tumor effect of chemically ... diacylglycerols of sea urchin Transplantation 74, 261–267 Mizushina Y, Watanabe I, Ohta K, Takemura M, Sahara H, Takahashi N, Gasa S, Sugawara F, Matsukage A, Yoshida S & Sakaguchi K (1998) Studies ... biopanning procedure and DNA sequence analysis A biotinylated derivative of SQAG was immobilized on a Streptavidin-coated ELISA plate (Nalge Nunc International, 2 137 A molecular target of SQAGs...
- 9
- 891
- 0
Báo cáo khoa học: The Promyelocytic Leukemia Zinc Finger (PLZF ) gene is a novel transcriptional target of the CCAAT-DisplacementProtein (CUX1) repressor ppt
... primer (5¢-aaatgtcttgaccagccgtc -3 ) and Chip2dw primer (5¢-gaaacaaaggcctctcccag -3 ); Chip3up primer (5¢-gctttgcagtcagaatggtc -3 ) and Chip3dw primer (5¢-ctgagcactgactacgaaac -3 ) The Chip1up and Chip1dw ... iProof DNA polymerase (Biorad) from the vector pGL3basic already containing a 2-kb region of the human PLZF gene The primer sequences used for the 3- kb 5¢-UTR were 3 HPLZF (5¢-gaggggaagaagcaaaagaga -3 ) ... Seattle, WA, USA) that targeted a conserved sequence in rat, mouse and human CUX1 was kindly provided by Dr Julian Downward [50] Two bases (in capitals) were further mutated (5¢-aagaaga acaGAccagaggattt -3 )...
- 13
- 359
- 0
Báo cáo y học: " Laugh syncope as a rare sub-type of the situational syncopes: a case report" potx
... etiology One populationbased study found that cardiac and neurologic syncope were associated with an increased risk of death from any cause and an increased risk of cardiovascular events and stroke, ... Cardiol 2001, 37 :1921-1928 Bragg MJ: Fall about laughing: a case of laughter syncope Emerg Med Australas 2006, 18:518-519 Arthur W, Kaye GC: Important points in the clinical evaluation of patients ... embolism, aortic dissection, myocardial infarction, left atrial myxoma, cardiac tamponade, atrioventricular block, sick sinus syndrome, tachyarrhythmia, bradyarrhythmia Neurally mediated (reflex mechanisms)...
- 4
- 190
- 0
báo cáo khoa học:" Fanconi anemia manifesting as a squamous cell carcinoma of the hard palate: a case report" pptx
... therapy and had not received a bone marrow transplant The haematological test revealed an early stage of pancytopenia (3, 4 × 109/l, Hb 12 ,3 g/dl, and platelets 13 × 109/l) Oral examination revealed ... International Fanconi Anaemia Registry (3% ) had HNSCC [11] In the same year Bremer presented two cases of HNSCC [15], but in international literature no article has reported a hard palate localization ... mucosa to the soft palate mucosa The nasopharynx appeared normal (Figure 2) No significant cervical lymphadenopathy was seen on the images An incisional biopsy performed under local anaesthesia...
- 5
- 245
- 0
Báo cáo y học: " Vascular endothelial growth factor as a non-invasive marker of pulmonary vascular remodeling in patients with bronchitis-type of COPD" pot
... acquisition of data, analysis and interpretation of data, and drafting of the manuscript KA participated in the analysis and interpretation of data, technical support, and critical revision of ... heart catheterization A balloontipped pulmonary arterial catheter was advanced to the pulmonary artery for measurement of pulmonary arterial pressure (PAP) and PWP In addition, a plastic catheter ... expression of vascular endothelial growth factor and vascular endothelial growth factor receptor in emphysema Am J Respir Crit Care Med 2001, 1 63: 737 -44 Kanazawa H, Asai K, Hirata K, Yoshikawa J: Possible...
- 7
- 257
- 0
Identification and characterization of protein kinase CK2 as a novel interacting protein of neuronal CDK5 kinase and its functional role in microtubule dynamics
... 1 .3. 2.2 Cdk5 in synapses and focal adhesion sites 31 1 .3. 2 .3 Cdk5 in neurosignaling 33 III 1 .3. 2.4 Cdk5 in transcriptional machineries 34 1 .3. 3 36 Molecular organization of Cdk5 complexes 1 .3. 3.1 ... Publications 145 VI Abbreviations a. a amino acid AD Alzheimer’s disease APP amyloid precursor protein ATP adenosine triphosphate c-abl c-Abelson CAK Cdk activating kinase CaMKII Ca2+/calmodulin-dependent ... reasonable since some potential substrates of CK2 are localized in the matrix of mitochondria (Meggio and Pinna, 20 03) CK2 has been identified as an endoplasmic reticulum (ER)-associated kinase...
- 182
- 480
- 0
Franchising as a modern contractual realization of distribution (Particularly in Slovakia)
... Nicola Broadhurst, What are the advantages and disadvantages of a franchise business opportunity, April 11, 2012, http://sellingafranchise.co.uk/what-are-the-advantages-and-disadvantages -of -a- franchise-businessopportunity ... and disadvantages, franchisees advantages and disadvantages and consumers’ advantages and disadvantages Chapter explains the contractual issues of franchising agreement It states the main structure ... Slovak Franchise Association, because of the lack of online information about current development of franchising in Slovakia Slovak Franchise Association has only information of its own participants,...
- 49
- 309
- 0
Module 8: Routing as a Solution for Private Network Connectivity
... Windows Media™ viewer are examples of applications that can take advantage of multicast transmissions RIP-for-IP version is an example of a protocol that can take advantage of multicast transmissions ... a single, high-bandwidth network segment Create stub areas whenever possible A stub area is an area that does not maintain routes to external autonomous systems Instead, stub areas use a default ... information for unicast packets Unlike RIP-for-IP routers, OSPF routers maintain a map of the network in the link state database Updates to the network are reflected in the link state database and...
- 50
- 371
- 0
Smoking and reproduction: The oviduct as a target of cigarette smoke ppt
... oviduct: a regulator of local contraction and gamete transport J Cardiovasc Pharmacol 2004, 44 Suppl 1:S248-51 111 Wijayagunawardane MP, Miyamoto A, Taquahashi Y, Acosta TJ, Nishimura M, Sato K: Angiotensin ... beat frequency assay Many of the compounds in Table were also screened using a chick chorioallantoic membrane (CAM) assay that measures growth of the CAM and chick embryo [188,189] In the CAM assay, ... smoking on nasal mucociliary clearance and ciliary beat frequency Thorax 1986, 41:519-5 23 178 Zayas JG, O'Brien DW, Tai S, Ding J, Lim L, King M: Adaptation of an amphibian mucociliary clearance model...
- 17
- 733
- 0
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx
... A1 , hnRNP E1 ⁄ E2 hnRNP A1 ASF ⁄ SF2 hnRNP A1 UUAGGACAUAUAGUUAGCCCUAGG unknown UGGGU CUAGACUAGA CCAGUAGAUCCUAGACUAGA GAAGAAGCGGAGACAGCGACGAAGA AGAUCCAUUCGAUUAG unknown UAGUGAAUAGAGUUAGGCAGGGA ... GAAGAAGAA UAGAAGAAGAA 4995–5017 [5, 12, 38 , 40] 536 2– 536 6 5428–5 437 5418–5 437 5558–5582 8047–8062 [48, 41, 15, 17, 8] A3 A5 A7 ISS ESE3 The HIV-1 encoded proteins Tat, which acts as a transactivator ... cells Proc Natl Acad Sci USA 91, 731 1– 731 5 32 Kamata M, Nitahara-Kasahara Y, Miyamoto Y, Yoneda Y & Aida Y (2005) Importin-alpha promotes passage through the nuclear pore complex of human immunodeficiency...
- 10
- 434
- 0
Báo cáo khoa học: Subcellular compartmentalization of FADD as a new level of regulation in death receptor signaling pdf
... nuclear FADD and its nuclear–cytoplasmic translocation? Functional DISC assembly and activation of caspase-8 is generally considered to be a ‘point of no return’ in the apoptotic signaling cascade ... of a transient nature Our data suggest a sequential model of signaling in which CD95 receptor activation generates early signals at the plasma membrane that lead to the translocation of nuclear ... between the nucleus and the cytoplasm Whereas cytoplasmic TRADD mediates apoptosis through FADD and caspase-8 activation, nuclear TRADD acts through a mitochondrial apoptosis pathway [28] Our study...
- 10
- 483
- 0
Báo cáo khoa học: Molecular characterization of recombinant mouse adenosine kinase and evaluation as a target for protein phosphorylation potx
... (PPM) and phosphoamino acid analysis (PAAA) of mAK-L preparatively phosphorylated by PKC (E) Site-directed mutagenesis analysis of PKC phosphorylation of mAK-L The Coomassie stain and autoradiogram ... Schizophrenia and Depression (JAB), the National Institute of Mental Health (ACN and RWG), the Department of Defense (JAB and AAF), the Department of Veterans A airs (RWG), and the Ella McFadden Charitable ... undefined regulatory factors The most abundant nucleoside kinase in mammals, AK has emerged as a key enzyme in the regulation of interstitial Ado and intracellular adenylate levels in the CNS and periphery...
- 9
- 497
- 0
Báo cáo khoa học: Quantitative assessment of the glyoxalase pathway in Leishmania infantum as a therapeutic target by modelling and computer simulation pot
... http://jjj.biochem.sun ac.za/database/silva/index.html free of charge Results and Discussion The potential of the glyoxalase system as a possible therapeutic target relies on its role as the main catabolic pathway ... the glyoxalase pathway in Leishmania braziliensis dates from 1988 [12] Only 16 years later was glyoxalase II characterized in Trypanosoma brucei [ 13] In this case, lactoyltrypanothione was found ... Sousa Silva et al The glyoxalase pathway in Leishmania infantum Table Glyoxalase I kinetic parameters in Leishmania infantum and other cells Initial rate analysis Glx I Substrate Km (mM) Leishmania...
- 11
- 515
- 0
Báo cáo khoa học: RIP1 comes back to life as a cell death regulator in TNFR1 signaling docx
... 592–600 73 Ashida H, Kim M, Schmidt-Supprian M, Ma A, Ogawa M & Sasakawa C (2010) A bacterial E3 ubiquitin ligase IpaH9.8 targets NEMO ⁄ IKKgamma to dampen the host NF-kappaB-mediated inflammatory ... 12, 633 –642 67 Nakajima A, Kojima Y, Nakayama M, Yagita H, Okumura K & Nakano H (2008) Downregulation of c-FLIP promotes caspase-dependent JNK activation and reactive oxygen species accumulation ... RIP1 and then the E3 ligase domain of A2 0 attaches degradative ubiquitin chains to RIP1, which targets RIP1 to the proteasome The deubiquitinase and E3 ligase activity of A2 0 are required for A2 0...
- 11
- 503
- 0
báo cáo hóa học:" Angiostatin anti-angiogenesis requires IL-12: The innate immune system as a key target" docx
... Mat Control AST/Mat AST Mat 0.00 Control AST/Mat AST Mat Control 0.05 1.0 0.8 0.015 0.01 0.010 AST/Mat AST 0.000 Mat AST/Mat AST Mat 0.00 Control AST/Mat AST Control 0.005 Mat Relative expression ... S, Javaherian K, Folkman J: Inhibition of plaque neovascularization reduces macrophage accumulation and progression of advanced atherosclerosis Proc Natl Acad Sci USA 20 03, 100:4 736 -4741 Chavakis ... keeps experimental metastasis in a dormant state [5] AST concentrations are elevated in fluids of animals harboring primary tumors [6] and other inflammatory and degenerative diseases [7,8] Following...
- 8
- 477
- 0
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc
... Ikegami H, Kobayashi T, Maruyama T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association between the interleukin-2 receptor-alpha gene and mode of onset of type diabetes ... regulatory T cell homeostasis and the maintenance of self-tolerance J Immunol 20 03, 171 :34 35 -34 41 49 Setoguchi R, Hori S, Takahashi T, Sakaguchi S: Homeostatic maintenance of natural Foxp3(+) ... JA: Cutting edge: CD28 controls peripheral homeostasis of CD4+CD25+ regulatory T cells J Immunol 20 03, 171 :33 48 -33 52 13 Kumanogoh A, Wang X, Lee I, Watanabe C, Kamanaka M, Shi W, Yoshida K, Sato...
- 12
- 573
- 0
Báo cáo hóa học: " Wireless network positioning as a convex feasibility problem" pot
... Figure 8, and we assume a pair of nodes, i.e., a pair of (target, reference) or a pair of (target, target) , can connect and estimate the distance between each other if that distance is less than 20 ... Ai = {j| reference node j can communicate with target i} and Bi = {j|j ≠ i, target j can communicate with target i} as the sets of all reference nodes and targets that can communicate with target ... estimation based on, for instance, time of flight for a reasonable signal-to-noise ratio [ 43] In contrast to POCS, which tries to find a point in the feasible set as an estimate, outer approximation...
- 15
- 366
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25