intangible is not stored and does not result in ownership a service is consumed at the point of sale services are one of the two key components of economics the other being goods
Báo cáo y học: " Intragenic transcriptional cis-activation of the human immunodeficiency virus 1 does not result in allele-specific inhibition of the endogenous gene" pdf
... AxTGCAGTGAGCCATGAxCACACCACAGTACxACAGCCTGGGTGATGAAxA AxATTGCTGTCCTAAxCAGACTGCACCTGTGGxGTGGCTCTGACTGGTxA AxGGTATGGTGGCAAAxCGACTCCCCCAGxACAACCACCAGAATATCAGxA AxACGCCGAAGTCGCxGAAGCAGATCTATCTGCxCTATGGTAAATCTGGxA AxATAACTGTTGCTAGGxGACGGGGACATTCCCGAAxGCTGCGTCTGTxA ... AxGTCGACCTGCAGACAxGGGTGATCCTCAxGTTTTCTAGGCAATxA AxAGTTTCCAGAAxTCCACACCGGAGACCCCACxTCCAGGATTCAAACCxT CxCAGCGTCCGCxCACTTCCTCCCCAAAACCCCxCCAAAAAAATTGTTxT AxGGTTGGTATAAACACAxAAAGCATGGTGGTxGTCTGGAGCTGGGGTTxA AxTGCAGTGAGCCATGAxCACACCACAGTACxACAGCCTGGGTGATGAAxA ... GGAATGGAACAGTGAAGAAGCA AATGGTAGATAACGCAGATCATC ACCACTGGAAAGGAACTAAGCA PROBES FOR RNA FISH HIV_MS2 HMBOX_E 1a HMBOX_E1b HMBOX_I 2a HMBOX_I2b HMBOX_I2c HMBOX_I2d HMBOX_E 4a HMBOX_E4b AxGTCGACCTGCAGACAxGGGTGATCCTCAxGTTTTCTAGGCAATxA...
- 15
- 329
- 0
Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot
... Comparison of structures of AMY2 and other a- amylases (not shown) also gave the impression that AMY2 might accommodate larger parts of the substrate Thus porcine pancreatic a- amylase like TAA had a larger ... domain B) from AMY2 (in green) and TAA (in black) The superimpositioning was guided by the catalytic acids (D179AMY2, E204AMY2, and D289AMY2 and D206TAA, E230TAA, and D297TAA) The invariant Y51AMY2 ... the valienamine ring in AMY2/acarbose (Fig 1A) Superpositioning of AMY2 and TAA guided by the catalytic acids was excellent for Tyr51AMY2 and Tyr82TAA (Fig 1A) and mutation in Saccharomycopsis...
- 14
- 557
- 0
Vision and Mission The Two Key Anchors That Add Passion and Purpose to Your Story
... company The first is that a manager automatically does an analysis of her mission as part of the planning process The second assumption is that those managers are well trained, so it is not necessary ... greatest sin of a combat officer is to be “off mission.” This creates unit failure and leads to organizational failure How you as a business leader a mission analysis? The same way I did as a combat ... Mission statements such as this example are abundant in businesses across the world Even worse are mission statements that are so vague and universal they say nothing This one was copied off the...
- 28
- 567
- 0
Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx
... GGATCCATCATGTTCTCATCATCATAATATG GGATCCGTTAAATATAATGCAGTGACGAAGATA GGATCCAAGTCAAACCTTGAGAAAGAACGA CACGGCATATTATGATGATGAGAACATGATGGATCTCG CGCGGATCCCCGGGTTAATTAA TTTAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTGAATTCGAGCTCGTTTAAAC ... TTTAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTGAATTCGAGCTCGTTTAAAC CAGAGAAACAAGCAAAACAAAAAGCTTTTCTTTTCACTAACGTATATGATGTTCAGCTTGAAAGC TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTTCAAATTGCTTTGGC ... ATH1_suc2 ATH1_pep4 ATH1_pLC1 ATGATGATGATAACAAAGGAGCTACAATCAAGGAAATTGTTCTCAATGATCGGATCCCCGGGTTAATTAA ATCCAAACTTATAATATTAAAAAAAGCGCTACTTATATGCATCATTTCATGAATTCGAGCTCGTTTAAAC GCACTAGTATGAAAAGAATAAGATCGCTTT...
- 15
- 475
- 0
Tài liệu COSMIC MAPS, PROPHECY CHARTS, AND THE HOLLYWOOD MOVIE, A BIBLICAL REALIST LOOKS AT THE ECLIPSE OF OLD TESTAMENT NARRATIVE* ppt
... origin to him From that starting point the Bible begins to unfold its cosmic map From that point the Bible begins to define what is real and what is not real, what is true and what is false, what ... did just as the LORD had commanded He raised his staff in the presence of Pharaoh and his officials and struck the water of the Nile, and all the water was changed into blood The fish in the Nile ... recently, Kaiser has taken a similar position, "The sources of the Nile's inundation are the equatorial rains that fill the White Nile, which originates in east-central Africa (present-day Uganda) and...
- 17
- 576
- 0
Báo cáo Y học: Monitoring the structural consequences of Phe12 fi D-Phe and Leu15 fi Aib substitution in human/rat corticotropin releasing hormone Implications for design of CRH antagonists pdf
... with the main features being the high degree of helical character and a small bend along the principal molecular axis As far as the ill-defined N terminus is concerned, all data (chemical shift index, ... also observed in Leu14–Val18 and Aib15–Leu19 All of the above data imply that the His13–Leu19 backbone structure is probably a conformational average bearing features of a pure a- helix and 310-helix ... devoid of any agonist activity, a fact particularly relevant to the further design and development of CRH antagonists with wide-ranging clinical applications in psychiatric disorders MATERIALS AND...
- 11
- 515
- 0
READING AND UNDERSTANDING ACADEMIC RESEARCH IN ACCOUNTING: A GUIDE FOR STUDENTS pdf
... alternative explanations Keep in mind that many alternative causes, such as natural ability or having a good day, are eliminated by random assignment Note that there is a difference between the random ... feel uncomfortable assessing the statistical tests (or other parts of the paper), rely on the fact that the statistical analysis was evaluated and approved by at least two other academics While you ... academic research can provide valuable insights to aid regulators in the creation of new GAAP and auditing standards, auditors in their assurance work, and financial statement preparers in avoiding common...
- 21
- 568
- 0
![Báo cáo khoa học: Benzo[a]pyrene impairs b-adrenergic stimulation of adipose tissue lipolysis and causes weight gain in mice A novel molecular mechanism of toxicity for a common food pollutant doc](https://media.store123doc.com/images/document/14/rc/rp/small_luUKRIz7Xm.jpg)
Báo cáo khoa học: Benzo[a]pyrene impairs b-adrenergic stimulation of adipose tissue lipolysis and causes weight gain in mice A novel molecular mechanism of toxicity for a common food pollutant doc
... were incubated with the indicated concentrations of ACTH In six separate experiments, the mean FFA concentration measured in the incubation media in absence of any pharmacological agents (basal ... accumulation of fat mass remains to be determined Available epidemiological data addressing the implication of PAH, in general, as a causal factor in the pathogeny of metabolic disorders are currently ... food intake, caused by the lack of a satiety signalling, whereas no change in food intake was detected in the B [a] P-treated animals In addition, the absolute values of leptin in control and B [a] P-treated...
- 11
- 424
- 0
báo cáo hóa học: " Social and dental status along the life course and oral health impacts in adolescents: a population-based birth cohort" ppt
... statistical analysis and interpretation of data, and drafted the manuscript MAP participated in the collection, analysis and interpretation of data, and revising critically the manuscript CLPA, AMBM, ... status at age 12 ** A+ B C D+E Untreated dental caries at age 12 No Yes Dental pain at age 12 No Yes Dental trauma at age 12 No Yes Dental fluorosis at age 12 No Yes Gingival bleeding at age 12 ... calibration exercises were carried out twice in December 1998 and May 1999 One of the authors was the standard examiner (MAP) Intra- and inter-examiner agreement was high, and the values for the...
- 10
- 469
- 0
báo cáo hóa học: " Reliability and validity of the Gastrointestinal Symptom Rating Scale (GSRS) and Quality of Life in Reflux and Dyspepsia (QOLRAD) questionnaire in dyspepsia: A six-country study" pptx
... [45,46] The HAD was not used in South Africa because the Afrikaans translation was not available at the start of the study All instruments have been translated and linguistically validated according ... translators Several translations of the GSRS and the QOLRAD are available, including Afrikaans, German, Hungarian, Italian, Polish and Spanish versions, and all have been psychometrically validated ... versions of the GSRS in the Indigestion domain, for the Hungarian version in the Diarrhoea domain, and for the Afrikaans, Hungarian, Polish and Spanish versions in the Constipation domain Intraclass...
- 12
- 590
- 0
status of postnatal care among mothers giving birth at the two hospitals in hanoi and an effect evaluation of home-based postnatal care model
... need is higher in urban area as mothers accessed information easier than those in rural area Mothers in rural area seem to hesitate to receive this kind of service This result is similar to another ... source of wate (only 4,6% mothers at urban area using drilling water while 26,2% mother at rural used drilling water, p
- 28
- 348
- 0
Báo cáo y học: " Combined rotation scarf and Akin osteotomies for hallux valgus: a patient focussed 9 year follow up of 50 patients" pptx
... which then become bruised, inflamed and painful Intraoperatively we always attempted to maintain the length of the first metatarsal and displace the metatarsal head in a plantarly direction as part ... (i) Accurate correction of the intermetatarsal angle, mm of lateral transposition of the metatarsal head equals 1° of intermetatarsal angle correction allowing intraoperative evaluation of the ... ellipse of tissue excised A beaver blade was introduced into the joint capsule between the metatarsal head and the sesamoid apparatus and the adductor hallucis tendon and lateral sesamoid ligament...
- 12
- 297
- 0
báo cáo khoa học: "Fatty acid profiles and their distribution patterns in microalgae: a comprehensive analysis of more than 2000 strains from the SAG culture collection" docx
... were integrated The amount of each FAME was calculated using a defined amount (1 μg) of the internal standard tripentadecanoate and the dry weight (DW) of each sample: area of peak × μg/area of ... multidimensional significance tests (Non-Parametric Multivariate Analysis of Variance, Analysis of Similarity) and visualised as ordinations from multigroup discriminant analysis (Canonical Variates Analysis) ... Phaeothamniophyceae and Raphidophyceae, just two strains are maintained at the SAG and, therefore, are not further discussed here Similarly, there is only a single strain of Chlorarachniophyta...
- 16
- 617
- 0
Báo cáo y học: " Social support and antenatal depression in extended and nuclear family environments in Turkey: a cross-sectional survey" potx
... comprehensive range of covariates Random sampling of antenatal clinics was not feasible in this setting because of difficulties in enumeration of these An approach was taken instead to maximise the heterogeneity ... spousal data Sample characteristics Distributions of covariates are summarised in the first column of Table The mean age was 25.9 years (SD 5.3, range 18-44), and the mean duration of education was ... structure was defined if another adult was living with the married couple in the same household In Turkish society this would nearly always be the mother -in- law and/ or father in- law of the woman since...
- 10
- 341
- 0
báo cáo khoa học: " Characterization and structural analysis of wild type and a non-abscission mutant at the development funiculus (Def) locus in Pisum sativum L" pdf
... means of dispersal and propagation so that plants are maintained from generation to generation However, premature abscission may result in loss of yield The identification and manipulation of ... structural analysis and the drafting of the manuscript MA contributed with plant material, the general idea of the study and participated in revision of the manuscript AKHE participated in the general ... showed a distinct double palisade layers at the same location In the testas of wild type pea seeds, the palisade layers in the hilum take their origin from the outer integuments and are made up of...
- 7
- 372
- 0
Báo cáo y học: " Exhaled nitric oxide and urinary EPX levels in infants: a pilot study" potx
... most of the sampling and was involved in the planning of the study CB participated in the planning and analysis of the study and helped to draft the manuscript AO contributed in the NO-measurements ... levels in infants were associated to building dampness, measured as windowpane condensation Measuring FeNO by the present method may be an interesting non-invasive way of evaluating early inflammation ... usefulness of two non-invasive methods, FeNO and uEPX measurement, for the evaluation of airway inflammation in infants and their mothers The present data support the conclusion that the method...
- 8
- 311
- 0
Enhancing third-year non-English major students' participation in speaking lessons through collaborative activities at Hanoi University of Business and Technolo
... to the data analysis Then the researcher can process the data and draw conclusions on that matter that to what extent CA can help students enhance their participation in class Organization of the ... promote elaboration and higher-order thinking Additionally, teachers should prepare and design the materials creatively and appropriately before teaching at class so that collaborative learning can ... that cooperative learning can increases learners‟ achievement The second basket is interpersonal relationships in which learners care about each other more and they are interested in each other' s...
- 71
- 1,032
- 2
Firm level performance and productivity analysis for software as a service companies
... that the boom of adopting SaaS software is not just another crazy technology fad Currently, several large software companies offer both SaaS applications and traditional packaged software applications ... “labor” in the literature), and intangible asset The first two variables are standard inputs in the productivity analysis literature and the last input is important for the production of software ... composited by AIPs, ASPs and end user Their findings indicated that the ASPs always determined their capacity at the maximum level of market demand and simply passed the risk of over- and under capacity...
- 94
- 248
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008