1. Trang chủ
  2. » Luận Văn - Báo Cáo

Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx

15 475 0

Đang tải... (xem toàn văn)

Tài liệu hạn chế xem trước, để xem đầy đủ mời bạn chọn Tải xuống

THÔNG TIN TÀI LIỆU

Thông tin cơ bản

Định dạng
Số trang 15
Dung lượng 714,23 KB

Nội dung

The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function Susu He1,2,3, Kerstin Bystricky4,5, Sebastien Leon6, Jean M Francois1,2,3 and Jean L Parrou1,2,3 ¸ University of Toulouse, INSA, UPS, INP & INRA, France ´ ` ´ ´ INRA-UMR 792 Ingenierie des Systemes Biologiques et procedes, Toulouse, France CNRS-UMR 5504, Toulouse, France ´ Laboratoire de Biologie Moleculaire Eucaryote, University of Toulouse, France CNRS-UMR5099, Toulouse, France ´ Institut Jacques Monod, UMR7592 CNRS ⁄ Universite Paris Diderot, France Keywords acid trehalase; cell surface; fluorescence microscopy; Saccharomyces cerevisiae; secretion Correspondence J M Francois, University of Toulouse, ¸ INSA, UPS, INP & INRA, 135, Avenue de Rangeuil, F-31077, Toulouse, France Fax: +33 6155 9400 Tel: +33 6155 9492 E-mail: fran_jm@insa-toulouse.fr (Received May 2009, revised June 2009, accepted 21 July 2009) doi:10.1111/j.1742-4658.2009.07227.x Previous studies in the yeast Saccharomyces cerevisiae have proposed a vacuolar localization for Ath1, which is difficult to reconcile with its ability to hydrolyze exogenous trehalose We used fluorescent microscopy to show that the red fluorescent protein mCherry fused to the C-terminus of Ath1, although mostly localized in the vacuole, was also targeted to the cell surface Also, hybrid Ath1 truncates fused at their C-terminus with the yeast internal invertase revealed that a 131 amino acid N-terminal fragment of Ath1was sufficient to target the fusion protein to the cell surface, enabling growth of the suc2D mutant on sucrose The unique transmembrane domain appeared to be indispensable for the production of a functional Ath1, and its removal abrogated invertase secretion and growth on sucrose Finally, the physiological significance of the cell-surface localization of Ath1 was established by showing that fusion of the signal peptide of invertase to N-terminal truncated Ath1 allowed the ath1D mutant to grow on trehalose, whereas the signal sequence of the vacuolar-targeted Pep4 constrained Ath1 in the vacuole and prevented growth of this mutant on trehalose Use of trafficking mutants that impaired Ath1 delivery to the vacuole abrogated neither its activity nor its growth on exogenous trehalose Introduction Trehalose [alpha-d-glucopyranosyl (1 fi 1) alpha-dgluocopyranoside] is a nonreducing disaccharide found in many organisms including yeasts, fungi, bacteria, plants and insects Trehalose is one of the major storage carbohydrates in the yeast Saccharomyces cerevisiae, accounting for > 25% of cell dry mass depending on the growth conditions and the life-cycle stage of the yeast [1–3] The accumulation of intracellular trehalose has two potential functions First, it constitutes an endogenous storage of carbon and energy during spore germination and in resting cells Second, trehalose acts as a stabilizer of cellular membranes and proteins [4–6] In S cerevisiae, trehalose is hydrolyzed to glucose by the action of two types of trehalase: ‘neutral trehalases’ encoded by NTH1 and NTH2 [3,7], which are optimally active at pH 7, and ‘acid trehalases’ encoded by ATH1, which show optimal activity at pH 4.5 [8] Although fungal acid trehalases, including those of the yeast Candida albicans [9] and Kluyveromyces lactis [10], have been reported to be localized at the cell surface, the localization of the S cerevisiae acid trehalase remains a matter of controversy In 1982, Wiemken and co-workers [11] first identified this protein in a vacuole-enriched fraction obtained by density gradient Abbreviations EndoH, endoglycosidase H; GH, glycolsyl hydrolase; GP, green fluorescent protein; MVB, multivesicular body; TM, transmembrane 5432 FEBS Journal 276 (2009) 5432–5446 ª 2009 The Authors Journal compilation ª 2009 FEBS S He et al centrifugation of a yeast protoplast preparation The vacuolar localization of acid trehalase was very recently supported by in vivo imaging analyses using green fluorescent protein (GFP)–Ath1 fusion constructs under the strong and constitutive TPI1 promoter [12] Furthermore, Huang et al used various trafficking mutants to show that this acid trehalase reaches its vacuolar destination via the multivesicular body (MVB) pathway However, this localization contrasts with the fact that this enzyme allows yeast to grow on exogenous trehalose [13] and with measurable Ath1 activity at the cell surface [14] The purpose of this study was to revisit this controversy regarding the localization of Ath1 in light of its biological function, combining cell biology and biochemical approaches To this end, we investigated the localization of Ath1 using strains expressing the red fluorescent protein mCherry fused to the C-terminus of Ath1 Integration of this construct at the ATH1 locus had the advantage of expressing the protein at levels comparable with those in wild-type cells, because it is reported that overexpression may cause the mislocalization of proteins into the vacuoles [15], and also to investigate the fusion protein under physiological conditions The domain responsible for targeting Ath1 at the cell surface and the role of the single transmembrane (TM) domain at the N-terminus of this protein were investigated The functional localization of Ath1 was further assessed by constructing various Ath1 hybrid proteins bearing different targeting signal peptides Together, our results demonstrated that the localization of Ath1 at the cell periphery is required for growth on trehalose, whereas the vacuolar localization of this protein is not compatible with growth on this carbon source Results Ath1 is localized at the cell periphery In a previous report, the localization of S cerevisiae Ath1 was visualized using a pGFPATH1 construct that expressed a GFP fused to the N-terminus of Ath1 under the strong TPI1 promoter [12] We obtained a comparable result with a GFP–Ath1 construct that was expressed under the control of the methioninerepressible MET25 promoter in a glucose medium lacking methionine (Fig 1A) However, western blotting using a GFP antibody on extracts from cells expressing GFP–Ath1 revealed a major band migrating at a position corresponding to  30 kDa, instead of bands migrating at > 150 kDa (Fig 1B) Fluorescence in the vacuole may therefore be caused by free GFP Functional localization of Ath1 in S cerevisiae which accumulated in this organelle because it has been reported that targeting of GFP-fusion proteins to the vacuolar lumen leads to their degradation by vacuolar proteases However, this degradation process is usually delayed, leading to the transient accumulation of GFP-containing proteolytic fragments of  30 kDa, and a sustained luminal vacuolar fluorescence [16] Note that a similar result was reported by Huang et al [12], although they were also able to detect a band corresponding to the native GFP–Ath1 This proteolytic problem, coupled with the fact that overexpression under a strong promoter has been reported to mislocalize some proteins into vacuoles [15], prompted us to re-examine the localization of Ath1 by fusing of GFP to its C-terminus, and expressing the corresponding ATH1–GFP fusion gene under the native promoter after integration at ATH1 locus Under this condition, we were able to observe a green signal at the cell periphery, although most of the signal was still localized in the lumen of the vacuole (Fig 1C) Similar results were obtained using the red fluorescent protein mCherry, which was also integrated at the ATH1 chromosomal locus, as well as with the tag fused at the N-terminus of Ath1 (data not shown) As for Ath1–GFP or GPF–Ath1 (see above), the Ath1–mCherry fusion protein was fully functional as indicated by the growth of this recombinant strain on trehalose and by enzymatic measurement (see below) Under live cell fluorescence microscopy, we observed a strong signal in the vacuolar compartment together with a clearly discernable signal at the cell periphery (Fig 1D) These results indicated that Ath1 may have two localizations, one in the vacuole, in agreement with previous studies [11,12], and another at the cell periphery, in accordance with its ability to hydrolyze exogenous trehalose [14] We then verified the Ath1– mCherry fusion protein by western blot This analysis made on extracts from yeast cells expressing the chimeric protein revealed a band at a size > 200 kDa with the rabbit anti-DsRed sera (Fig 1E) Because this signal disappeared upon endoglycosidase H (EndoH) treatment, the glycosylation that was reported for this protein [7] may explain this migration property at an apparent size much higher than expected However, the expected band at a size of 164 kDa (Ath1 + mCherry) was barely detected upon EndoH treatment, and instead, a relatively strong band migrating at around 65 kDa could be identified (Fig 1E) As a second, independent way to support the localization of Ath1 at the cell periphery, we used the invertase secretion system Invertase is a secreted protein with a classical signal peptide at its N-terminus (amino acids 1–19) for secretion at the cell periphery FEBS Journal 276 (2009) 5432–5446 ª 2009 The Authors Journal compilation ª 2009 FEBS 5433 Functional localization of Ath1 in S cerevisiae S He et al Fig Cellular localization of Ath1 Yeast cells in the exponential phase (D600  1.0) expressing fusions of Ath1 to GFP or mCherry were collected for live cell microscopy (A,C,D) and western blotting (B,E) Bar length = lm (A,B) BY4742 ath1D transformed with pGFP–ATH1 under the MET25 promoter in YN glucose without methionine (A) (left) fluorescence, (right) DIC (B) Immunoblot with anti-GFP of crude extract before ()) and after (+) N-deglycosylation by EndoH; (C) BY4741 bearing ATH1–GFP integrated at the ATH1 locus in YN trehalose (D,E) BY4741 bearing ATH1– mCherry integrated at the ATH1 locus in YN trehalose (D) Microscopy and (E) immunoblot with the DsRed polyclonal antibody of crude extract before ()) and after (+) N-deglycosylation by EndoH M, Molecular mass marker; arrowhead, expected fulllength fusion protein at 150 kDa; asterisk, degradation product Deletion of this signal peptide (suc2ic allele) prevents secretion and results in the accumulation of the truncated form of the enzyme in the cell, impairing the ability of S cerevisiae to grow on sucrose or raffinose as the sole carbon source We generated an inframe fusion of full-length ATH1 and suc2ic (pSC1–ATH1), leading to the chimeric Ath1–Suc2 protein expressed under the ATH1 promoter As shown in Fig 2, suc2D mutant expressing this gene construct recovered growth on sucrose, like the positive control expressing the full-length secreted invertase under its own promoter (pLC1), whereas suc2D mutant transformed with pSC1 lacking of signal peptide grew very poorly on sucrose, probably using amino acids present in the medium (Fig 2B) Consistent with this, these cells also recovered invertase activity in both crude extract and intact cells (Fig 3), albeit five times lower than that measured in suc2D mutant transformed with pLC1 Fig Complementation of the S cerevisiae SEY6210 strain (suc2D mutant) with different Ath1–invertase chimera (A) Schematic representation of the different gene fusion constructs pSC1, negative control (invertase without signal peptide); pLC1, positive control (full-length invertase); for the remaining constructs, the Suc2 signal peptide has been replaced by full-length ATH1 sequence (pSC1–ATH1) or N-terminal sequence variants of ATH1 with decreasing size; (B) growth on YP medium with sucrose (complementation test) or glucose (control) for days 5434 FEBS Journal 276 (2009) 5432–5446 ª 2009 The Authors Journal compilation ª 2009 FEBS S He et al Functional localization of Ath1 in S cerevisiae cleavage of the disaccharide by an acid trehalase localized at the cell surface Searching for the minimal domain of Ath1 for invertase secretion Fig Invertase activity in the S cerevisiae SEY6210 strain (suc2D mutant) transformed with the various Ath1–invertase constructs The constructs are those shown in Fig Transformed cells were cultivated in YP sucrose medium until the stationary phase before measurement of invertase activity on intact cells and in crude extract as described in Experimental procedures Histograms show the results of two independent experiments (mean ± SD) Replacing the ATH1 promoter in pSC1–ATH1 with the stronger SUC2 promoter resulted in an invertase activity similar to that in pLC1 (data not shown) We noticed that the invertase activity in a crude extract of cells transformed with pLC1 was lower than that in intact cells This may be caused by incomplete lysis of the cells or partial denaturation of proteins during extraction and vortexing with glass beads In addition to the cell biology data, we also revalidated our enzymatic assay of acid trehalase Our current method is based on the measurement of the activity in intact cells according to the procedure employed to measure secreted invertase [17], in which NaF is added to the incubation mixture to block glucose uptake We verified that the use of NaF did not cause any enzymatic artifact, for example, cell lysis or the release of intracellular glucose First, incubation of intact cells from an exponential culture grown on glucose that not express acid trehalase because of glucose repression [18] in a reaction mixture optimal for neutral trehalase activity and containing NaF did not lead to any glucose production from trehalose (data not shown) This excluded the possibility of cell leakage and the release of proteins or intracellular glucose under NaF treatment Further validation of our assay was the successful measurement of acid trehalase activity on intact cells from a mutant completely defective for glucose uptake (hxt1-17D strain) [19] cultivated on glycerol and ethanol as the carbon source, which allowed ATH1 expression, even in the absence of NaF (data not shown) These elements demonstrated that the glucose measured in intact cells resulted from Full-length Ath1–invertase fusion protein was targeted at the cell surface, suggesting the existence of a secretion sequence in Ath1 As shown in Fig 4, domain prediction using the smart program [20,21] did not reveal any classical signal peptide for secretion at the N-terminus of Ath1 This in silico analysis only revealed a short 23 amino acid TM domain near the N-terminus, followed by three ‘glycosyl hydrolase’ (GH) domains (amino acids 132–415, 474–845 and 849–904) that together may constitute the catalytic domain of Ath1 [22] To map the minimal domain of Ath1 that allows the secretion of this protein, various DNA fragments of ATH1 were fused inframe with the suc2ic allele (Fig 2A) A series of plasmids, namely pSC1–N that carried a fusion to the first 131 N-terminal amino acids of Ath1, pSC1–TM bearing a fusion to the first 69 amino acids of Ath1, which includes the TM domain, and pSC1–tm that only bears the first 46 amino acids of Ath1 excluding the TM domain, were introduced into the suc2D mutant SEY6210 Transformants were tested for growth recovery on sucrose (Fig 2B) and for invertase activity (Fig 3) As shown in Fig 2B, suc2D mutant cells transformed with pSC1– N or pSC1–TM were able to grow on YP sucrose as readily as pSC1–ATH1, whereas cells transformed with pSC1–tm poorly grew on sucrose, as did cells bearing the negative control pSC1 Invertase activity was measured in intact cells and crude extracts from suc2D mutant transformed with these various constructs, compared with growth efficiency on sucrose (Figs and 3) Cells transformed with pSC1–N showed an activity nearly twofold higher than that in cells expressing a fusion to the full-length Ath1 (pSC1–ATH1) One explanation might be that the full size Ath1 fused to internal invertase somehow Fig Ath1 predicted functional domain using the SMART program Theoretical glycosylation sites (yellow triangles); N-terminal transmembrane segment (TM); N-term (GH_65N), central (GH_65m) and C-term (GH_65C) domains from the CAZy glycoside hydrolase family 65 The latter three domains likely constitute the catalytic core of trehalase FEBS Journal 276 (2009) 5432–5446 ª 2009 The Authors Journal compilation ª 2009 FEBS 5435 Functional localization of Ath1 in S cerevisiae S He et al impairs folding of the invertase domain and ⁄ or the catalytic efficiency on its substrate Despite this difference, as for pSC1–ATH1, the activity in intact cells was comparable with that in cell extract, and both transformed cells showed similar qualitative growth on sucrose The activity measured in intact cells expressing pSC1–TM was four times lower than that in the crude extract, and two to four times lower than in intact cells transformed with pSC1–ATH1 and pSC1–N Bearing in mind this low activity, pSC1–TM transformed cells were found to grow slightly more slowly on sucrose than cells transformed with pSC1– ATH1 Further reduction at the N-terminus (i.e with pSC1–tm) resulted in residual invertase activity in the crude extract, together with an inability to grow on sucrose Taken together, these results showed that a minimal fragment of 69 amino acids encompassing the unique TM domain of Ath1 was needed to promote correct expression of the internal invertase, but was not sufficient for efficient protein secretion, which was achieved with a 131 amino acid N-terminus of Ath1 Fig The N-terminal domain of Ath1 is needed for the localization of mCherry at the cell periphery Live cell microscopy of exponentially growing cells in YN trehalose medium of the BY4741 strain transformed with pN–mCherry (A) or with path1DN–mCherry (B) Removal of the N-terminus of Ath1 caused a strict vacuolar localization Because the 131 amino acid N-terminus of Ath1 appeared to be sufficient for invertase secretion, we further investigated the targeting properties of this fragment by using a mCherry fusion that was expressed under the control of the ATH1 promoter (pN–mCherry) Figure 5A shows a fluorescent signal at the cell periphery and a stronger signal in the vacuole, similar to that observed using full-length Ath1 fused to mCherry (compare Figs 5A and 1D) This result confirmed that the N-terminal part of Ath1 was sufficient to target the recipient protein to these two cellular compartments Reciprocally, we analyzed the consequences of deleting the first 100 codons of the ATH1 sequence (path1DN) on red protein localization When expressed in a wild-type strain grown on trehalose, the Ath1DN– mCherry fusion protein led to a fluorescent signal exclusively in the vacuole (Fig 5B) No discernable signal could be detected at the cell periphery, even after 10-fold longer exposure times From this result, we first verified that a BYath1D mutant transformed with the centromeric plasmid pATH1 carrying the wild-type ATH1 gene recovered wild-type characteristics, i.e growth on trehalose as the sole carbon source (not shown), and acid trehalase activity in both intact cells and cell crude extracts (Fig 6) However, when this ath1D mutant was transformed by path1DN it was not able to grow on trehalose (data not shown) and 5436 Fig Acid trehalase activity of ath1D mutant cells expressing various ATH1 constructs The BY4741 ath1D mutant strain transformed with gene constructs expressing different Ath1 variants was cultivated in YN glucose to late exponential phase (D600  8) with plasmid selection The cells were then collected and transferred to YPD medium until the stationary phase (D600  20) to allow ATH1 derepression Acid trehalase activity was measured in intact cells and crude extracts as described in Experimental Procedures Histograms show the results of two independent experiments (mean ± SD) had no Ath1 activity (Fig 6) From these data, we were able to confirm that the 131 amino acid N-terminal fragment contains important information for cell-surface targeting, and we suggest that there may be vacuolar targeting determinants in the catalytic domain, as in the case of acid phosphatase [23] FEBS Journal 276 (2009) 5432–5446 ª 2009 The Authors Journal compilation ª 2009 FEBS S He et al Substitution of the N-terminus of Ath1 by the invertase signal peptide restored acid trehalase activity and growth on trehalose The exclusive, strong vacuolar signal observed in the absence of the 100 amino acid N-terminus of Ath1, together with the subsequent loss of catalytically active trehalase (Ath1DN variant), suggested that the vacuolar fraction consisted mainly of inactive Ath1 We therefore asked whether targeting of Ath1 to the cell periphery could restore trehalase activity We made use of the invertase secretion property by fusing the signal peptide of this protein to the N-terminus of the Ath1DN variant Fig 7A) When transformed in ath1D mutant cells, the resulting plasmid pSPSUC2– ATH1DN did allow recovery of the growth ability on trehalose and the acid trehalase activity in both cell crude extract and intact cells (Fig 6) Moreover, the ath1D mutant strain bearing this plasmid grew about two times faster than wild-type BY4741 strain on synthetic trehalose medium (l = 0.10 versus 0.047; Fig 8) Localization of this hybrid protein was verified by C-terminal fusion to mCherry Setting our exposure time as in Fig 1, we found that the intensity of the fluorescent signal at the cell periphery was significantly higher than that of the full-length Ath1–mCherry protein (compare Figs 7B and 1D) However, the bulk of the fluorescent signal still resided in the vacuolar compartment, which substantiated the idea that the catalytic domain of Ath1 contains some targeting signal for the vacuole Using western blot analysis, we found a 65kDa proteolytic fragment that was already Functional localization of Ath1 in S cerevisiae obtained with the Ath1–mCherry fusion protein (Fig 1C), but also a clearly detectable band corresponding to the SPSuc2–Ath1DN–mCherry chimeric protein after EndoH treatment (173 kDa, Fig 7C), indicating better stability for this construct than for native Ath1 Overall, these results suggest that secretion of Ath1 at the cell periphery is associated with the stabilization and physiological function of this protein Constraining Ath1 to the vacuole impaired growth on trehalose Although Ath1 can be targeted to the cell periphery, the vacuolar localization appeared to be the major destination for this protein, as illustrated by the strong vacuolar signal obtained using fluorescence microscopy To check the possible function of the vacuolar pool of acid trehalase for growth on trehalose, we sought a strategy to constrain all Ath1 in this intracellular compartment To this end, we fused the signal peptide of the vacuolar protein Pep4 [24] to the N-terminus of the truncated Ath1DN variant Very interestingly, when transformed in ath1D mutant cells, the plasmid pSPPEP4–ATH1DN did not allow recovery of the growth on trehalose (Fig 8), although the cells did exhibit acid trehalase activity in the crude extract, which accounted for  50% of the activity measured in cells expressing SPSuc2–Ath1DN (data not shown) As shown in Fig 7D, microscopy analysis confirmed that the SPPep4–Ath1DN–mCherry chimeric protein was exclusively targeted to the vacuole when expressed in the wild-type strain This strongly indicated that the Fig Cellular localization of the Ath1 catalytic core fused to different signal peptides (Panel I, A) Schematic representation of SUC2, PEP4 and ATH1 nucleotide sequences with emphasis on the 5¢-end containing targeting information Nucleotides 1-111 and 1-267 of SUC2 and PEP4, respectively, replaced nucleotides 1-300 of ATH1 giving the SPSUC2–Ath1DN and SPPEP4– Ath1DN chimeras (Panel II) BY4741 cells were transformed with pSPSUC2–ath1DN– mCherry and cultivated in YN trehalose medium Exponential growing cells were collected for live cell microscopy (B), and immunoblot on crude extract before ()) and after (+) deglycosylation with EndoH using DsRed polyclonal antibody (C) (D) BY4741 cells transformed with pSPPEP4–ath1DN– mCherry were collected for live cell microscopy M, molecular mass markers; arrowhead, expected full-length fusion protein; asterisk, degradation product FEBS Journal 276 (2009) 5432–5446 ª 2009 The Authors Journal compilation ª 2009 FEBS 5437 Functional localization of Ath1 in S cerevisiae S He et al Fig Growth complementation of the ath1D mutant strain on trehalose After a preculture on a selective YN glucose medium, the BY4741 ath1D mutant strain expressing the catalytic domain of Ath1 (amino acids 301 to 1211) fused to signal sequence of Suc2 and Pep4, respectively, were transferred in YN trehalose medium to evaluate growth complementation BY4741, positive control; ath1D, negative control vacuolar pool of acid trehalase has no role in trehalose assimilation for cell growth As a complementary approach, we used mutants of genes involved in the vacuolar sorting pathway, like VPS4 which encodes a protein implicated in the delivery of proteins from the prevacuolar compartment to the vacuole [25] As shown in Fig 9A, the intracellular red fluorescent signal derived from Ath1–mCherry was totally mislocalized in a vps4D mutant, being completely excluded from the lumen of vacuole However, the fluorescent signal at the cell periphery was still visible in this vps4D mutant and the relative Ath1 activity between intact cells and crude extract was identical to that of wild-type cells (Fig 9B) The presence of the Ath1–mCherry fusion protein was also monitored in this mutant using the rabbit anti-DsRed sera In untreated extract, a band migrating at  200 kDa was relatively comparable in this mutant and the wild-type (data in Figs 9C and 1C can be compared because similar amount of protein were loaded) After EndoH treatment, the expected 164 kDa band was visible, whereas the abundance of the 65 kDa band was drastically reduced compared with that in Fig 1C, indicating significantly decreased proteolysis of this protein when preventing vacuolar targeting Together, these results confirmed that trehalase in the vacuole is likely prompted to partial degradation and is not required for cell growth on trehalose The TM domain is indispensable for Ath1 function Previous studies have indicated that the short TM domain located at the N-terminus of Ath1 contained sufficient signaling information to deliver Ath1 to the vacuole via the MVB pathway [12] As already observed when studying invertase fusions, the requirement for a minimal N-terminal fragment encompassing the TM domain indicated the importance of this domain in protein expression and secretion (see the minimal construct pSC1–tm in Figs and 3) We confirmed this by studying pSC1–ath1DTM and pSC1–NDTM, in which the TM domain was specifically deleted in the full-length ATH1–SUC2 gene Fig Localization and activity of Ath1 in vps4D mutant Cells cultivated in YN trehalose medium to the exponential phase were collected for live cell microscopy (A), and to test the activity of acid trehalase in intact cells or cell crude extracts (B), as described in Experimental Procedures Histograms show the results of two independent experiments (mean ± SD) (C) Crude extract from vps4D cells expressing Ath1–mCherry immunoblotted with the DsRed polyclonal antibody, before ()) and after (+) deglycosylation with EndoH M, molecular mass markers Bar = lm 5438 FEBS Journal 276 (2009) 5432–5446 ª 2009 The Authors Journal compilation ª 2009 FEBS S He et al fusion and in its truncated variant, respectively When transformed in suc2D mutant, these constructs did not restore growth on sucrose or invertase activity (Fig 10A) Similarly, when using BYath1D mutant as a recipient strain for functional complementation by various Ath1 variants, the plasmid path1DTM, which expressed an Ath1 protein lacking the TM domain, was not able to complement growth deficiency of this mutant on trehalose or yield measurable Ath1 activity in this strain (data not shown) Finally, when using the pNDTM–mCherry plasmid that expressed a fusion of the N-terminal fragment lacking the TM domain to mCherry, the fluorescence was observed in cytoplasmic patches distinct from the vacuole (Fig 10B) The absence of Ath1 activity in crude extracts when TM was deleted from the protein prompted us to verify whether removal of this short TM domain may hamper expression of these constructs For this purpose, Ath1 and its ath1DTM variant were tagged with 3HA at their N-terminus The ath1 mutant transformed with pHA–ATH1 expressing the Ath1–HA fusion protein recovered growth on trehalose, although the chimeric protein could not be detected by western blotting, probably because of its very low expression level We therefore replaced the ATH1 promoter with the strong, inducible GAL1 promoter, leading to very high Ath1 activity in cells transformed with pPGAL1– HA–ATH1 (data not shown) By contrast, no activity Functional localization of Ath1 in S cerevisiae was measured in cells transformed with pPGAL1–HA– ath1DTM, although the gene construct was expressed (data not shown) These results were confirmed by western blot analysis using anti-HA IgG, which revealed a band at  130 kDa (wild-type Ath1) after EndoH treatment of protein extracts from cells expressing pPGAL1–HA–ATH1; no band was detected when the TM domain was missing from the protein (Fig 10C) These results supported the idea that absence of the TM domain may lead to a deficiency in protein production, which likely occurred during the early steps of endoplasmic reticulum protein synthesis and ⁄ or during folding Discussion Vacuolar Ath1 is also found at the cell surface Controversy concerning the localization of Ath1 has been raised in two recent papers In a previous study, we suggested a localization for Ath1 at the cell surface based on enzymatic data because most Ath1 activity could be measured in intact cells [14], in a manner similar to that for the secreted invertase [17] However, Huang et al [12] provided several arguments for a strict vacuolar localization of Ath1, identifying the MVB pathway as the main transport route for sorting this protein into the vacuole In this paper, we used Fig 10 Role of the single transmembrane (TM) domain in protein expression (A) Left, schematic view of chimera proteins Ath1DTM–invertase and NDTM–invertase, respectively Right, complementation tests of Suc2D mutant by these two constructions on YP sucrose agar for days, and invertase activity (IA) (B) BY4741 cells transformed with plasmid pNDTM–mCherry were cultivated in YN trehalose medium to the exponential phase and collected for live cell imaging (C) The HA–ATH1 or HA–ATH1DTM gene constructs expressing Ath1 with or without the TM sequence tagged with HA under the GAL1 promoter were transformed into ath1D mutant cultivated in YN galactose EndoH-treated crude extracts were immunoblotted with the anti-HA IgG Lane 1, wild-type Ath1 (negative control); lane 2, HA–Ath1; lane 3, HA–Ath1DTM M, molecular mass markers FEBS Journal 276 (2009) 5432–5446 ª 2009 The Authors Journal compilation ª 2009 FEBS 5439 Functional localization of Ath1 in S cerevisiae S He et al two independent methodologies, fluorescence microscopy and gene fusion to invertase, which together provided evidence that Ath1 is also targeted to the cell surface Using the GFP or the red fluorescent protein mCherry fused to the C-terminus of Ath1, we clearly observed a localization of Ath1 at the cell periphery, although the bulk fluorescent signal was still seen in the vacuole A possible reason for the failure of Huang et al [12] to find Ath1 at the cell periphery may be that these authors used a GFP–Ath1 construct that was expressed from the strong constitutive TPI1 promoter, because we obtained similar results using GFP– Ath1 expressed from another strong MET25 promoter However, we examined the localization of Ath1 in cells expressing either Ath1–GFP or Ath1–mCherry cultivated on trehalose, whereas Huang et al [12] investigated this localization problem using exponentially growing cells on glucose It can be proposed that the correct localization of Ath1 is dependent on the substrate (in this case, trehalose), as shown for the control of Fur4 permease by uracile [26] When expressed under its own promoter, as in our study, ATH1 is repressed by glucose [18] and the localization of Ath1 can be examined only in the stationary phase Thus, the use of a glucose medium to study the localization of Ath1 can be cautioned because it is not physiologically relevant for this protein Further evidence for a cell-surface localization of Ath1 was obtained by showing that expression of the Ath1–Suc2 protein fusion allowed recovering suc2D mutant to grow on sucrose, indicating that the full-length Ath1 protein was able to drive the yeast internal invertase to the cell surface These cell biology data were further supported by the revalidation of our enzymatic assay of acid trehalase on intact cells, confirming that glucose measured in NaF-treated intact cells results from the cleavage of the disaccharide at the cell surface by an extracellular ‘acid trehalase’ pool [14] The cell-surface localization accounts for growth on trehalose It is known that Ath1 hydrolyzes exogenous trehalose to grow on this carbon source Based on an exclusive vacuolar localization for this protein, two models have been proposed [27] The first suggested that Ath1 is transported to the plasma membrane where it binds to trehalose located at the cell surface; both trehalose and trehalase are then internalized by endocytosis into the vacuole where hydrolysis takes place According to the results of Huang et al [12], this model may be discarded because transport of Ath1 via the MVB pathway en route to the vacuole bypasses the plasma 5440 membrane The second model considered that trehalose alone is delivered to the vacuole by endocytosis, where it is hydrolyzed by the resident Ath1 However, this model requires the identification of a trehalose endocytosis process and this is difficult to reconcile with mono- and disaccharides entering the cell by sugar permeases [19], and yeast cells possessing a highaffinity trehalose transporter encoded by AGT1 [28] Instead, we provide arguments that support a more simple model [14], in which trehalose can be assimilated by either a Agt1–Nth1 pathway, implicating the uptake and intracellular hydrolysis by neutral trehalase, or by direct hydrolysis of trehalose by the extracellular acid trehalase encoded by ATH1 into glucose, which is thereafter taken up by the cells These two pathways only function in a MAL-positive strain such as the CEN.PK background because expression of AGT1 is MAL dependent Because the sequenced BY4741 strain is mal-negative, the assimilation of exogenous trehalose can rely only on the Ath1-dependent pathway [14] Moreover, this model is consistent with what has been shown for fungal and plant acid trehalases, which are all localized at the cell surface or cell wall [22,29,30] In addition to these data, other results support this model First, constraining acid trehalase in the vacuole by replacing its 100 amino acid N-terminal fragment with the signal sequence of the vacuolar Pep4 [24], a protein known to be specifically targeted to the vacuole, prevented growth on trehalose Second, impairment of Ath1 delivery to the vacuole using vps4D mutants defective in the MVB pathway did not abrogate growth on trehalose or the activity of Ath1 on intact cells Although Ath1 is present at the cell periphery, our data,together with those from Huang et al [12], showed an apparent large accumulation of this protein in the vacuole, as monitored by the fluorescence intensity from GFP- or mCherry-tagged protein However, this result contrasted with enzymatic data showing that Ath1 activity measured in crude extract was only 20–40% higher than that measured in intact cells One explanation for this discrepancy can be found from western blot analysis in which full-length Ath1 fused to reporter mCherry was barely detected, whereas a partially proteolysed Ath1 fragment was predominantly observed Also, use of a vps4D strain impaired Ath1 delivery to the vacuole and significantly reduced its proteolysis Similar observations were obtained with the vps1D strain (S He, unpublished), which was initially identified as a protein involved in transport from the late-Golgi complex to the prevacuolar compartment [31] in the vacuole protein-sorting pathway To summarize, these results demonstrated that the vacuole FEBS Journal 276 (2009) 5432–5446 ª 2009 The Authors Journal compilation ª 2009 FEBS S He et al Functional localization of Ath1 in S cerevisiae is not the obligate functional destination for Ath1, and that partial proteolysis of Ath1 could take place in this subcellular compartment In contrast, targeting this enzyme at the cell surface is indispensable for growth of yeast cells on trehalose Ath1 domains relevant for cell-surface targeting and protein function The finding that Ath1 could be targeted at the cell periphery raised questions about secretion determinants because domain-predicting tools did not identify any sequence feature to explain Ath1 intracellular trafficking Klionsky and co-workers [12] showed that the short TM domain located at the N-terminus of Ath1 contained sufficient information to deliver Ath1 to the vacuole via the MVB pathway They reached this conclusion using a chimeric construct in which only the TM domain was fused to GFP Alternatively, we specifically removed the unique TM domain from fulllength Ath1 or from the 131 amino acid N-terminal fragment fused to Suc2, and found that absence of this TM domain abrogated the activity of invertase and growth on sucrose More remarkably, removal of TM in Ath1 led to a complete loss of enzyme activity and the inability of a HA antibody to detect the HA– Ath1DTM construct Because we were able to verify that the absence of Ath1 protein was not caused by inefficient ATH1 transcription (not shown), these results suggested a critical function for the TM domain in the translation and ⁄ or stabilization of Ath1 during early secretion steps This also fits with the mislocalization of the NDTM–mCherry chimera in cytosolic patchy bodies, whose origin is currently unknown As indicated by hybrid Ath1–invertase fusions, a 131 amino acid N-terminal fragment was needed to recover normal invertase secretion, whereas reducing this N-terminal fragment to only 69 amino acids decreased the secretion and activity of invertase at the cell surface Taking this result together with those using the reporter protein mCherry, the minimal information for correct targeting to the cell surface is likely localized between amino acids 69 (after the TM domain) and 131 of Ath1 protein sequence Several intracellular enzymes in yeast, in particular the glycolytic enzymes glyceraldehyde dehydrogenase [32], 3-phosphoglycerate mutase [33] and enolase [34,35], were found to be secreted at the cell surface although they did not harbor any classical signal sequence for secretion Nombela et al [36] proposed that these signalless proteins could be exported by nonclassical export systems, such as those identified in mammals and parasites, which involve membrane blebbing (bubble formation) and secondary-structure elements that might also contribute to export [37] A common feature between these glycolytic enzymes and S cerevisiae Ath1 is the lack of a classical secretion sequence However, because Ath1 is not a cytosolic protein, these modes of secretion remain unknown By contrast, the classical secretion pathway cannot be excluded because it was reported that mutations that cause accumulation of secretory proteins in the endoplasmic reticulum (sec18) or in the Golgi apparatus (sec7) led to diminished Ath1 activity [38,39] Also, previous findings of co-purification of Ath1 with cell-surface secreted proteins such as invertase [7,40] and Ygp1 [41] further supported this mode of secretion In conclusion, the secretion pathway for Ath1 needs to be thoroughly reinvestigated using specific mutants altered in various secretion processes Experimental procedures Strains, media and culture conditions BY4741 (MAT a his3-D1 leu2-D0 ura3-D0 met15-D0), BY4742 (MAT a his3-D1 leu2-D0 lys2-D0 ura3-D0) and SEY6210 (MAT a his3-D200 leu2-3,112 lys2-801 trp1-901 ura3-52 suc2-D9) were used as recipient strains for various gene constructs, as described in Table Yeast transforma- Table Strains used in this study Euroscarf, Institute of Molecular Biosciences, Johann Wolfgang Goethe-University Frankfurt, Germany; ´ H Bussey, McGill University, Quebec, Canada Strain Genotype Reference BY4741 BY4742 SEY6210 BY4741 ath1D BY4741 vps4D BY4741 ATH1_GFP BY4741 ATH1_mCherry BY4741 vps4D ATH1_mCherry hxt1-17D MAT a his3-D1 leu2-D0 ura3-D0 met15-D0 MATa his3-D1 leu2-D0 Lys2-D0 ura3-D0 MAT a his3-D300 leu2-3,112 lys2-801 trp1-901 ura3-52 suc2-D9 MAT a his3-D1 leu2-D0 ura3-D0 met15-D0 ath1D::KanMX4 MAT a his3-D1 leu2-D0 ura3-D0 met15-D vps4D::KanMX4 MAT a his3-D1 leu2-D0 ura3-D0 met15-D0 ATH1-GFP-His3MX6 MAT a his3-D1 leu2-D0 ura3-D0 met15-D0 ATH1-mCherry-His3MX6 MAT a his3-D1 leu2-D0 ura3-D0 met15-D0 vps4D::KanMX4 ATH1-mCherry-His3MX6 MATa hxt1-17 gal2 Euroscarf Euroscarf Gift of H Bussey This study Euroscarf This study This study This study [19] FEBS Journal 276 (2009) 5432–5446 ª 2009 The Authors Journal compilation ª 2009 FEBS 5441 Functional localization of Ath1 in S cerevisiae S He et al tion was performed according to the lithium acetate method, as described in Woods & Gietz [42] The vps4D mutant used in this study was derived from the Euroscarf deletion collection (BY background) The ath1D null mutant was constructed by replacing the gene of interest with selective cassettes KanMX4 using in vivo homologous recombination Unless otherwise stated, yeast cells were cultured in yeast nitrogen base (YN) synthetic medium (0.17% w ⁄ v yeast nitrogen base without amino acid and without ammonium, supplemented with 0.5% ammonium sulfate w ⁄ v, buffered to pH 4.8 with sodium succinate ⁄ NaOH and with the auxotrophic amino acids when required) A carbon source glucose, galactose, sucrose or trehalose was added up to 2% (w ⁄ v) Cultures were carried out at 30 °C in shaking flasks at a shaking speed of 170 rpmỈmin)1 Plasmids construction To construct N-terminal truncated versions of Ath1, primers ATH1_)1000_BH and ATH1_+508 (for primers list see Table 2) were used to amplify a DNA fragment carrying the ATH1 gene and its promoter and terminator from extracted genomic DNA of BY4741 This PCR product was first cloned in pGEM-T-easy vector and a cut BamHI ⁄ PstI fragment was inserted into centromeric YCplac33 (linearized by BamHI and PstI) to construct pATH1 (for plasmids list see Table 3) Mutagenesis of the TM domain of Ath1 was carried out using the four nucleotides recombinant PCR method [43] Use of ATH1_A and ATH1_D external primers, together with the internal mutagenic primers ATH1_B and ATH1_C, led to the deletion of nucleotides 139–207 that encode the TM domain of Ath1 The recombinant PCR fragment was cloned into the pGEMT-easy vector and cut by AgeI ⁄ AflII digestion to replace the AgeI ⁄ AflII fragment in pATH1, which yielded path1DTM The same method was used to construct path1DN, with the primers ATH1_E, ATH1_F, ATH1_G and ATH1_D that lead to the deletion of nucleotides 1-300 of ATH1 sequence To fuse the signal peptide of Suc2 to the catalytic domain of Ath1, the following constructions were carried out using the centromeric plasmid pLC1 containing the SUC2 gene (1602 bp) flanked by its own promoter [44] The pSPSUC2–ath1DN plasmid was constructed by replacing the fragment coding the catalytic domain of invertase, which starts from the 112th nucleotide to the stop codon (remaining 5¢-end fragment including the region coding signal peptide of Suc2) of SUC2 in pLC1 by the ath1 allele without its 5¢-end 300 bp (Fig 7) To construct pSPPEP4– ath1DN, the SUC2 ORF in pLC1 was replaced by the PEP4 (1218 bp) ORF, which was amplified using the primers PEP4_D and PEP4_R The 3¢-end (951 bp) fragment encoding the catalytic domain of Pep4 (amplified by using primers ATH1_pep4 and ATH1_pLC1), was removed and replaced by the ath1 allele without its 300 bp 5¢-end in order to yield pSPPEP4–ath1DN 5442 Plasmids bearing Ath1-truncated fusion proteins inframe to the intracellular invertase encoded by suc2ic allele were constructed by using another centromeric plasmid pSC1 containing a suc2ic allele lacking its signal sequence [44] Using the plasmid pATH1 as the template, PCR fragments containing 1000 bp of ATH1 promoter sequence and part of the 5¢-end of ATH1 coding sequence were obtained using ATH1_)1000_BH as the forward primer and the following reverse primers: ATH1_3633_BH for amplification of fulllength ATH1 coding sequence (without the stop codon); ATH1_395_BH for the ‘N’ construct that carries an allele version of ATH1 that stops just before the catalytic domain of Ath1 (amino acid 131); ATH1_209_BH for the ‘TM’ construct that stops just after the TM domain of Ath1 (at amino acid residue 69); and ATH1_140_BH for the ‘tm’ construct that stops just before the TM domain (amino acid residue 41); Similarly, using path1DTM as template, ATH1_)1000_BH forward primer together with ATH1_3633_BH and ATH1_395_BH were used to obtain ‘ath1DTM’ and ‘NDTM’ constructs, respectively In order to achieve in frame fusion with suc2ic allele, all these PCR fragments were cloned in pGEM-T-easy vector and excised by BamHI digestion for subcloning into the BglII site of pSC1 to produce plasmids pSC1–ATH1, pSC1–N, pSC1– TM, pSC1–tm, pSC1–ath1DTM and pSC1–NDTM, respectively Ath1 was tagged with 3HA at the N-terminal end by inserting 3HA after the start codon ATG of ATH1 For this purpose, two rounds of the recombinant PCR were successively carried out First, we fused ATH1 promoter (primers ATH1_1 and ATH1_2) and the 3HA (primers HA_D and HA_R, using pFA6a–3HA–KanMX6 as template), using ATH1_1 and HA_R as external primers Second, this recombinant PCR product was fused to an ATH1 5¢-end PCR product (primers ATH1_3 and ATH1_4) using ATH1_1 and ATH1_4 as external primers This final HAtagged PCR fragment was cloned into the pGEM-T-easy vector and was then excised by SnaBI ⁄ AgeI to replace the SnaBI ⁄ AgeI fragment in pATH1 and path1DTM, respectively, to obtain pHA–ATH1 and pHA–ath1DTM Using the plasmid pFA6a–KanMX6–PGAL1 as the template, the primers PGAL_D and PGAL_R were used to amplify a GAL1 promoter PCR cassette that was co-transformed into yeast cells with SnaBI-linearized plasmids pHA–ATH1 and pHA–ath1DTM, respectively Cells carrying recombinant plasmids pPGAL1–HA–ATH1 or pPGAL1–HA–ath1DTM, which express the HA-tagged versions of Ath1 under the strong promoter GAL1 instead of the native promoter, were selected in the absence of uracil Construction of fluorescent fusion proteins ATH1 was amplified from the plasmid pATH1 using the primers ATH1_pUG36_D and ATH1_pUG36_R This PCR product was first cloned in pGEM-T-easy vector and FEBS Journal 276 (2009) 5432–5446 ª 2009 The Authors Journal compilation ª 2009 FEBS S He et al Functional localization of Ath1 in S cerevisiae Table Primer sequences for PCR Restriction sites are shown in bold, underlined and homologue recombination region in italics Name Oligo sequence F2_ATH1 R1_ATH1 ATH1_pUG36_D ATH1_pUG36_R ATH1_)1000_BH ATH1_+508 ATH1_A ATH1_B ATH1_C ATH1_D ATH1_E ATH1_F ATH1_G ATH1_3633_BH ATH1_395_BH ATH1_209_BH ATH1_140_BH mCherry–pSC1_D mCherry–pSC1_R HA_D HA_R ATH1_1 ATH1_2 ATH1_3 ATH1_4 PGAL_D PGAL_R R1_pLC1 PEP4_D PEP4_R SGA1_D SGA1_R ATH1_suc2 ATH1_pep4 ATH1_pLC1 ATGATGATGATAACAAAGGAGCTACAATCAAGGAAATTGTTCTCAATGATCGGATCCCCGGGTTAATTAA ATCCAAACTTATAATATTAAAAAAAGCGCTACTTATATGCATCATTTCATGAATTCGAGCTCGTTTAAAC GCACTAGTATGAAAAGAATAAGATCGCTTT GCCCCGGGATCATTGAGAACAATTTCC GCGGATCCGTATGACCACATTCTATACTGA GAGCCAATATCAAATCTGGTGGTAATCC GAGGAACAAAAATAGTACCGGTAATAAC GTAAGCCTGGAACTCTTTGT GTCAAACCTTGAGAAAGAAC GTTCTTTCTCAAGGTTTGAC ACAAAGAGTTCCAGGCTTAC CAAATCTATGATTTCTTAAGGGCCA AGCAAGCACTACGTATCACGACAAACCAAC GCTTCTGGATCGTAGTTCAA CATTATTGGAATGAGGAAAT ATTTCCTCATTCCAATAATG TTGAACTACGATCCAGAAGC GGATCCTCATTGAGAACAATTTCCTTGA GGATCCATCATGTTCTCATCATCATAATATG GGATCCGTTAAATATAATGCAGTGACGAAGATA GGATCCAAGTCAAACCTTGAGAAAGAACGA CACGGCATATTATGATGATGAGAACATGATGGATCTCG CGCGGATCCCCGGGTTAATTAA TTTAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTGAATTCGAGCTCGTTTAAAC ATTTCCTCATTCCAATAATG TACCCATACGATGTTCCTG CAAAGCGATCTTATTCTTTT AGCGTAATCTGGAACGTC ACTACGTATCACGACAAACCAACAGCCG TCAGGAACATCGTATGGGTA CATTATTGGAATGAGGAAA ATGACGTTCCAGATTACGCT AAAAGAATAAGATCGCTT TTACCGGTACTATTTTTGTTCCTCAAACTAGGAG GTATGACCACATTCTATACTGAGAAGAGTGCCTATATAAATCATCGTCAGGTAAAGAGCCCCATTATCTT GGGACGTCATACGGATAGCCCGCATAGTCAGGAACATCGTATGGGTACATGGGTTTTTTCTCCTTGACG TTTAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTGAATTCGAGCTCGTTTAAAC CAGAGAAACAAGCAAAACAAAAAGCTTTTCTTTTCACTAACGTATATGATGTTCAGCTTGAAAGC TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTTCAAATTGCTTTGGC CAGAGAAACAAGCAAAACAAAAAGCTTTTCTTTTCACTAACGTATATGATGGCAAGACAAAAGATGTT TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTCTACAAACTCTGTAAAACTT AACGGCCCTTCGCAAGTGCAGCTGCGGGATGCAGTCTTGATGAATGGGTTGAACTACGATCCAGAAGC TTCACTGAAGGTGGTCACGATGTTCCATTGACAAATTACTTGAACGCATTGAACTACGATCCAGAAGC TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTTTAATCATTGAGAACAATTTCCTTGATTG a cut SpeI ⁄ SmaI fragment was inserted into plasmid pUG36 (linearized by SpeI and SmaI) to construct pGFP– ATH1 The GFP–His3MX6 or mCherry–His3MX6 cassette that contains the gene encoding GFP or mCherry was amplified from plasmid pFA6a–GFP–His3MX6 or pFA6a– mCherry–His3MX6 (kind gift of S Bachellier-Bassi, Institut Pasteur, Paris, France) Primers F2_ATH1 and R1_ATH1 were used to amplify the GFP–His3MX6_ATH1 and mCherry–His3MX6_ATH1, which were integrated into the genome of the wild-type strain BY4741 or vps4D mutant by homologous recombination, for C-terminal tagging of Ath1 with GFP or mCherry The path1DN–mCherry vector was constructed by in vivo homologous recombination after co-transformation of yeast cells with the mCherry–His3MX6_ATH1 PCR cassette together with plasmids path1DN, and selection of the recombinant plasmid in the absence of both uracil and histidine Similarly, co-transformation of a mCherry–His3MX6 PCR cassette that was obtained from primers F2_ATH1 and R1_pLC1, together with pLC1 derivative plasmids described above, led to mCherry–tagged versions of Ath1 chimeric variants, i.e pSPSUC2–ath1DN– mCherry and pSPPEP4–ath1DN–mCherry The two plasmids pN–mCherry and pNDTM–mCherry were obtained by replacing the suc2ic allele sequence by mCherry in plasmids pSC1–N and pSC1–NDTM This was carried out by co-transformation into yeast cells of a mCherry PCR cassette obtained from primers mCherry– pSC1_D and mCherry–pSC1_R, together with AgeI-linearized pSC1–N and pSC1–NDTM, respectively Western blotting Crude cell extract was prepared in the same way as crude extract for trehalase activity measurement [14] with FEBS Journal 276 (2009) 5432–5446 ª 2009 The Authors Journal compilation ª 2009 FEBS 5443 Functional localization of Ath1 in S cerevisiae S He et al Table Plasmids used in this study GFP, green fluorescent protein; TM, transmembrane Plasmid Description Ref YCplac33 pLC1 pSC1 pFA6a–GFP–His3MX6 pFA6a–mCherry–His3MX6 Centromeric plasmid Centromeric plasmid, containing SUC2 ORF Centromeric plasmid, containing suc2ic allele without sequences coding signal peptide As a PCR template for amplifying GFP sequence As a PCR template for amplifying mCherry sequence pFA6a–3HA–KanMX6 pFA6a–KanMX6–PGAL1 pUG36 As a PCR template for amplifying 3HA sequence As a PCR template for amplifying the promoter GAL1 For a N-terminal GFP fusion construction under promoter MET25 pATH1 pGFP–ATH1 path1DN path1DTM ATH1 ORF with its promoter and terminator cloned in YCplac33 To overexpress the chimeric protein GFP–Ath1 ATH1 variant without 5¢-end 300 nucleotides cloned in YCplac33 ATH1 variant without 5¢-end 139-207 nucleotides coding TM domain (aa 47-69) cloned in YCplac33 To express a chimeric protein with the signal peptide of invertase fused to Ath1DN To express a chimeric protein with the signal peptide of Pep4 fused to Ath1DN To express a chimeric protein with HA tag in the N-terminus of Ath1 To express a chimeric protein with HA tag in the N-terminus of Ath1DTM Bearing mCherry at the 3¢-end of ath1DN Bearing mCherry at the 3¢-end of SPSUC2-ath1DN Bearing mCherry at the 3¢-end of SPPEP4-ath1DN ATH1 ORF fused to 5¢-end of suc2ic allele ATH1 5¢-end 395 nucleotides fused to 5¢-end of suc2ic allele ATH1 5¢-end 209 nucleotides fused to 5¢-end of suc2ic allele ATH1 5¢-end 140 nt fused to 5¢-end of suc2ic allele ath1DTM fused to 5¢-end of suc2ic allele ATH1 5¢-end 395 nucleotides with a gap of 139-207 nucleotides coding the TM domain (amino acids 47-69) fused to 5¢-end of suc2ic allele ATH1 5¢-end 395 nucleotides fused to 5¢-end of mCherry ATH1 5¢-end 395 nucleotides with a gap of 139-207 nucleotides coding TM domain (amino acids 47-69) fused to 5¢-end of mCherry [45] [46] [46] [47] Gift of S Bachellier-Bassi [47] [47] Gift of Hegemann JH This study This study This study This study pSPSUC2–ath1DN pSPPEP4–ath1DN pPGAL1–HA–ATH1 pPGAL1–HA–ath1DTM path1DN–mCherry pSPSUC2–ath1DN–mCherry pSPPEP4–ath1DN–mCherry pSC1–ATH1 pSC1–N pSC1–TM pSC1–tm pSC1–ath1DTM pSC1–NDTM pN–mCherry pNDTM–mCherry additional protease inhibitor (Roche, Basel, Switzerland, NO.11836170001) Crude extract containing tagged proteins was first treated with EndoH for h at 37 °C Western blots were performed using the primary mouse mAb antiHA IgG (Roche, No 11583816001) at a dilution of ⁄ 2000 or mouse mAb anti-GFP IgG (Roche, NO 11814460001) at a dilution of ⁄ 1000 or rabbit living colors DsRed polyclonal antibody (Clontech, Palo Alto, CA, USA, NO.632496) at a dilution of ⁄ 1000, and the secondary antibody horseradish peroxidase-conjugated goat antimouse or rabbit IgG at a dilution of ⁄ 20000 supplied in SuperSignal West Pico Complete Mouse (Pierce, Rockford, IL, USA, NO 34081) or rabbit (Pierce, NO 34084) IgG Detection Kit Fluorescence and microscopy Fluorescent protein tagged cells were cultivated in YN trehalose or glucose medium to reach the exponential 5444 This This This This This This This This This This This This This study study study study study study study study study study study study study This study This study phase, and then cells were collected by centrifugation (3000 g, min) Images were captured on a Metamorph driven Olympus IX81 wide-field microscope equipped with a Coolsnap HQ camera and a Polychrome V (Till Photonics, Munich, Germany) A 100· ⁄ 1.4 Oil Plan-Apochromat objective from Zeiss was used Exposure times were 500 ms for GFP (excitation k = 490 nm) and 2000 ms for mCherry (excitation k = 590 nm) Images were minimally adjusted for brightness and contrast using photoshop Assay of trehalase and invertase activity Yeast cells (D  100) were harvested by centrifugation (3000 g, min) and washed twice Activity of acid trehalase and invertase on intact cells and in crude extract was measured as described in [14] The activity was expressed as nmol of glucose released from either trehalose or sucrose per minute and per D600 FEBS Journal 276 (2009) 5432–5446 ª 2009 The Authors Journal compilation ª 2009 FEBS S He et al Functional localization of Ath1 in S cerevisiae Acknowledgements We thank S Bachellier-Bassi for generously providing us with the pFA6a–mCherry–His3MX6 plasmid Microscopy analyses were performed at the RIO microscopy facility in Toulouse, France This work was partially supported by ANR Blanc grant n° 05-242128 to JMF SH holds a fellowship for PhD students from the Research Grants China Scholarship Council 12 13 14 References Lillie SH & Pringle JR (1980) Reserve carbohydrate metabolism in Saccharomyces cerevisiae: responses to nutrient limitation J Bacteriol 143, 1384–1394 Hottiger T, Boller T & Wiemken A (1987) Rapid changes of heat and desiccation tolerance correlated with changes of trehalose content in Saccharomyces cerevisiae cells subjected to temperature shifts FEBS Lett 220, 113–115 Jules M, Beltran G, Francois J & Parrou JL (2008) New insights into trehalose metabolism by Saccharomyces cerevisiae: NTH2 encodes a functional cytosolic trehalase, and deletion of TPS1 reveals Ath1p-dependent trehalose mobilization Appl Environ Microbiol 74, 605–614 Singer MA & Lindquist S (1998) Thermotolerance in Saccharomyces cerevisiae: the Yin and Yang of trehalose Trends Biotechnol 16, 460–468 Simola M, Hanninen AL, Stranius SM & Makarow M (2000) Trehalose is required for conformational repair of heat-denatured proteins in the yeast endoplasmic reticulum but not for maintenance of membrane traffic functions after severe heat stress [In Process Citation] Mol Microbiol 37, 42–53 Francois J & Parrou JL (2001) Reserve carbohydrates metabolism in the yeast Saccharomyces cerevisiae FEMS Microbiol Rev 25, 125–145 Mittenbuhler K & Holzer H (1988) Purification and characterization of acid trehalase from the yeast suc2 mutant J Biol Chem 263, 8537–8543 Destruelle M, Holzer H & Klionsky DJ (1995) Isolation and characterization of a novel yeast gene, ATH1, that is required for vacuolar acid trehalase activity Yeast 11, 1015–1025 Pedreno Y, Maicas S, Arguelles JC, Sentandreu R & Valentin E (2004) The ATC1 gene encodes a cell walllinked acid trehalase required for growth on trehalose in Candida albicans J Biol Chem 279, 40852–40860 10 Swaim CL, Anton BP, Sharma SS, Taron CH & Benner JS (2008) Physical and computational analysis of the yeast Kluyveromyces lactis secreted proteome Proteomics 8, 2714–2723 11 Keller F, Schellenberg M & Wiemken A (1982) Localization of trehalase in vacuoles and of trehalose in the 15 16 17 18 19 20 21 22 23 24 25 cytosol of yeast (Saccharomyces cerevisiae) Arch Microbiol 131, 298–301 Huang J, Reggiori F & Klionsky DJ (2007) The transmembrane domain of acid trehalase mediates ubiquitinindependent multivesicular body pathway sorting Mol Biol Cell 18, 2511–2524 Nwaka S, Mechler B, Destruelle M & Holzer H (1995) Phenotypic features of trehalase mutants in Saccharomyces cerevisiae FEBS Lett 360, 286–290 Jules M, Guillou V, Francois J & Parrou JL (2004) Two distinct pathways for trehalose assimilation in the yeast Saccharomyces cerevisiae Appl Environ Microbiol 70, 2771–2778 Roberts CJ, Nothwehr SF & Stevens TH (1992) Membrane protein sorting in the yeast secretory pathway: evidence that the vacuole may be the default compartment J Cell Biol 119, 69–83 Leon S, Erpapazoglou Z & Haguenauer-Tsapis R (2008) Ear1p and Ssh4p are new adaptors of the ubiquitin ligase Rsp5p for cargo ubiquitylation and sorting at multivesicular bodies Mol Biol Cell 19, 2379–2388 Silveira MC, Carvajal E & Bon EP (1996) Assay for in vivo yeast invertase activity using NaF Anal Biochem 238, 26–28 San Miguel PF & Arguelles JC (1994) Differential changes in the activity of cytosolic and vacuolar trehalases along the growth cycle of Saccharomyces cerevisiae Biochim Biophys Acta 1200, 155–160 Wieczorke R, Krampe S, Weierstall T, Freidel K, Hollenberg CP & Boles E (1999) Concurrent knock-out of at least 20 transporter genes is required to block uptake of hexoses in Saccharomyces cerevisiae FEBS Lett 464, 123–128 Schultz J, Copley RR, Doerks T, Ponting CP & Bork P (2000) SMART: a web-based tool for the study of genetically mobile domains Nucleic Acids Res 28, 231–234 Letunic I, Doerks T & Bork P (2009) SMART 6: recent updates and new developments Nucleic Acids Res 37, D229–D232 Parrou JL, Jules M, Beltran G & Francois J (2005) Acid trehalase in yeasts and filamentous fungi: localization, regulation and physiological function FEMS Yeast Res 5, 503–511 Haguenauer-Tsapis R (1992) Protein-specific features of the general secretion pathway in yeast: the secretion of acid phosphatase Mol Microbiol 6, 573–579 Ammerer G, Hunter CP, Rothman JH, Saari GC, Valls LA & Stevens TH (1986) PEP4 gene of Saccharomyces cerevisiae encodes proteinase A, a vacuolar enzyme required for processing of vacuolar precursors Mol Cell Biol 6, 2490–2499 Bryant NJ & Stevens TH (1998) Vacuole biogenesis in Saccharomyces cerevisiae: protein transport pathways to the yeast vacuole Microbiol Mol Biol Rev 62, 230–247 FEBS Journal 276 (2009) 5432–5446 ª 2009 The Authors Journal compilation ª 2009 FEBS 5445 Functional localization of Ath1 in S cerevisiae S He et al 26 Blondel MO, Morvan J, Dupre S, Urban-Grimal D, Haguenauer-Tsapis R & Volland C (2004) Direct sorting of the yeast uracil permease to the endosomal system is controlled by uracil binding and Rsp5pdependent ubiquitylation Mol Biol Cell 15, 883– 895 27 Nwaka S & Holzer H (1998) Molecular biology of trehalose and the trehalases in the yeast Saccharomyces cerevisiae Prog Nucleic Acid Res Mol Biol 58, 197–237 28 Plourde-Owobi L, Durner S, Parrou JL, Wieczorke R, Goma G & Francois J (1999) AGT1, encoding an alpha-glucoside transporter involved in uptake and intracellular accumulation of trehalose in Saccharomyces cerevisiae J Bacteriol 181, 3830–3832 29 Muller J, Aeschbacher RA, Wingler A, Boller T & Wiemken A (2001) Trehalose and trehalase in Arabidopsis Plant Physiol 125, 1086–1093 30 Frison M, Parrou JL, Guillaumot D, Masquelier D, Francois J, Chaumont F & Batoko H (2007) The Arabidopsis thaliana trehalase is a plasma membrane-bound enzyme with extracellular activity FEBS Lett 581, 4010–4016 31 Vater CA, Raymond CK, Ekena K, Howald-Stevenson I & Stevens TH (1992) The VPS1 protein, a homolog of dynamin required for vacuolar protein sorting in Saccharomyces cerevisiae, is a GTPase with two functionally separable domains J Cell Biol 119, 773– 786 32 Gil-Navarro I, Gil ML, Casanova M, O’Connor JE, Martinez JP & Gozalbo D (1997) The glycolytic enzyme glyceraldehyde-3-phosphate dehydrogenase of Candida albicans is a surface antigen J Bacteriol 179, 4992– 4999 33 Alloush HM, Lopez-Ribot JL, Masten BJ & Chaffin WL (1997) 3-Phosphoglycerate kinase: a glycolytic enzyme protein present in the cell wall of Candida albicans Microbiology 143, 321–330 34 Edwards SR & Chaffin WL (1999) Enolase is present in the cell wall of Saccharomyces cerevisiae FEMS Microbiol Lett 177, 211–216 35 Lopez-Villar E, Monteoliva L, Larsen MR, Sachon E, Shabaz M, Pardo M, Pla J, Gil C, Roepstorff P & Nombela C (2006) Genetic and proteomic evidences support the localization of yeast enolase in the cell surface Proteomics 6, S107–S118 5446 36 Nombela C, Gil C & Chaffin WL (2006) Non-conventional protein secretion in yeast Trends Microbiol 14, 15–21 37 Prudovsky I, Mandinova A, Soldi R, Bagala C, Graziani I, Landriscina M, Tarantini F, Duarte M, Bellum S, Doherty H et al (2003) The non-classical export routes: FGF1 and IL-1alpha point the way J Cell Sci 116, 4871–4881 38 Harris SD & Cotter DA (1987) Vacuolar (lysosomal) trehalase of Saccharomyces cerevisiae Curr Microbiol 15, 245–249 39 Mittenbuhler K & Holzer H (1991) Characterization of different forms of yeast acid trehalase in the secretory pathway Arch Microbiol 155, 217–220 40 Biswas N & Ghosh AK (1996) Characterisation of an acid trehalase of Saccharomyces cerevisiae present in trehalase–sucrase aggregate Biochim Biophys Acta 1290, 95–100 41 Destruelle M, Holzer H & Klionsky DJ (1994) Identification and characterization of a novel yeast gene: the YGP1 gene product is a highly glycosylated secreted protein that is synthesized in response to nutrient limitation Mol Cell Biol 14, 2740–2754 42 Woods RA & Gietz RD (2001) High-efficiency transformation of plasmid DNA into yeast Methods Mol Biol 177, 85–97 43 Pont-Kingdon G (1994) Construction of chimeric molecules by a two-step recombinant PCR method BioTechniques 16, 1010–1011 44 del Castillo AL, Nieto SA & Sentandreu R (1992) Differential expression of the invertase-encoding SUC genes in Saccharomyces cerevisiae Gene 120, 59–65 45 Gietz RD & Sugino A (1988) New yeast–Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites Gene 74, 527–534 46 Castillo L, Martinez AI, Gelis S, Ruiz-Herrera J, Valentin E & Sentandreu R (2008) Genomic response programs of Saccharomyces cerevisiae following protoplasting and regeneration Fungal Genet Biol 45, 253–265 47 Wach A, Brachat A, Pohlmann R & Philippsen P (1994) New heterologous modules for classical or PCRbased gene disruptions in Saccharomyces cerevisiae Yeast 10, 1793–1808 FEBS Journal 276 (2009) 5432–5446 ª 2009 The Authors Journal compilation ª 2009 FEBS ... ATTTCCTCATTCCAATAATG TTGAACTACGATCCAGAAGC GGATCCTCATTGAGAACAATTTCCTTGA GGATCCATCATGTTCTCATCATCATAATATG GGATCCGTTAAATATAATGCAGTGACGAAGATA GGATCCAAGTCAAACCTTGAGAAAGAACGA CACGGCATATTATGATGATGAGAACATGATGGATCTCG... ATCCAAACTTATAATATTAAAAAAAGCGCTACTTATATGCATCATTTCATGAATTCGAGCTCGTTTAAAC GCACTAGTATGAAAAGAATAAGATCGCTTT GCCCCGGGATCATTGAGAACAATTTCC GCGGATCCGTATGACCACATTCTATACTGA GAGCCAATATCAAATCTGGTGGTAATCC GAGGAACAAAAATAGTACCGGTAATAAC... TCAGGAACATCGTATGGGTA CATTATTGGAATGAGGAAA ATGACGTTCCAGATTACGCT AAAAGAATAAGATCGCTT TTACCGGTACTATTTTTGTTCCTCAAACTAGGAG GTATGACCACATTCTATACTGAGAAGAGTGCCTATATAAATCATCGTCAGGTAAAGAGCCCCATTATCTT GGGACGTCATACGGATAGCCCGCATAGTCAGGAACATCGTATGGGTACATGGGTTTTTTCTCCTTGACG

Ngày đăng: 18/02/2014, 06:20

TỪ KHÓA LIÊN QUAN

TÀI LIỆU CÙNG NGƯỜI DÙNG

TÀI LIỆU LIÊN QUAN