Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx

... GCTTCTGGATCGTAGTTCAA CATTATTGGAATGAGGAAAT ATH1_G ATTTCCTCATTCCAATAATG TTGAACTACGATCCAGAAGC ATH1_3633_BH GGATCCTCATTGAGAACAATTTCCTTGA ATH1_395_BH GGATCCATCATGTTCTCATCATCATAATATG ATH1_209_BH GGATCCGTTAAATATAATGCAGTGACGAAGATA ATH1_140_BH GGATCCAAGTCAAACCTTGAGAAAGAACGA mCherry–pSC1_D ... recombination region in italics. Name Oligo sequence F2_ATH1 ATGATGATGATAACAAAGGAGCTACAATCAAGGAAATTGTTCTCAATGA...

Ngày tải lên: 18/02/2014, 06:20

... The intracellular concentration of heme is maintained by the rate of its synthesis and degrada- tion [1]. Many enzymes and their regulators are responsible for heme synthesis [1,2]. On the other hand, ... in the accumulation of heme in the hemin- treated HepG2 cells. Taken together with the siHO-2- mediated induction of HO-1 expression, these results suggest that HO-2 rather...

Ngày tải lên: 19/02/2014, 05:20

... melanoma cell line, but in contrast to what was observed in RAW 264.7 cells, the mutant was able to efficiently kill these cells. These data are consistent with the notion that induction of pyroptosis ... suggests that different types of cells are killed by LF as a result of the cleavage of distinct substrates. To summarize, we have isolated an LF mutant that is impaired in its abi...

Ngày tải lên: 16/02/2014, 09:20

... In the case of the T domain, the MG state corresponds to the functional state, which initi- ates the translocation of the catalytic domain. Here, the data allowed identification of the core of the ... structure, TH5 is partly accessible at the surface of the T domain. We propose that its high protection is caused by the formation of dimers. Within the molten...

Ngày tải lên: 16/02/2014, 09:20

... Ð k f a2 k r a2 S a2 Á S À! k cat a2 S a2 þ S a1 ð1Þ The autophosphorylation rate (v 3 ) is the sum of the rates catalyzed by each form. Applying quasi steady- state (QSS) approximation for the intermediate com- plexes, ... and the activatory residue is dephosphorylated; S is the partially active form, where both the inhibitory and activatory resi- dues are dephosphoryla...

Ngày tải lên: 18/02/2014, 11:20

... that there is always a K eq position for maximum electron flux through the enzyme. On either side of this optimum, the electron flux drops off because either the formation rate (k 2 ) or dissociation ... kinetic model for NOS catalysis. Ferric enzyme reduction (k r ) is rate limiting for the biosynthetic reactions (central linear portion). kcat1 and kcat2 are the conversion...

Ngày tải lên: 18/02/2014, 11:20

... induced by ischemia during AMI or PCI remain to be elucidated. Delineation of the molecular basis for our observations is essential to evaluate the elevated DNase I activity in the sera of patients ... indi- cated by overbars. The underlines repre- sent the locations of the two oligonucleotide probes used for further ana- lysis. The position and identity of mutations at...

Ngày tải lên: 19/02/2014, 06:20

... to study the tissue-specific use of each promoter. We show the translation initiation site of isoform 2 and different intracellular distribution of isoforms 1 and 2, and discuss the regulatory mechan- ism ... initi- ation sites. Determining the translation initiation site of isoform 2 KLK11 Messenger RNA for isoform 2 contains two initiation codons near the 5¢ end. To examine wheth...

Ngày tải lên: 19/02/2014, 06:20

... droplet accumulation, respectively. Phosphatidylserine is a lipid that is enriched in the inner face of the plasma membrane and that is translocated into the outer face under certain cellular states. ... with ferric citrate. Rather, these oxidants induced cell death of HepG2 cells (data not shown). Upregulated CD1d expression and alterations in lipid parameters Considering that...

Ngày tải lên: 19/02/2014, 16:20

... stimulated for 5 min if not indicated otherwise. All experiments were carried out in duplicate at least three times, if not otherwise indicated. Western Blotting Equal amounts of cell lysate proteins ... induces the activation and phosphorylation of Ras-GRF1. Furthermore, Ras-GRF1 is also heavily phosphorylated upon agon- ist activation of GPCRs, but the exact role of these phosph...

Ngày tải lên: 19/02/2014, 18:20