initiation of inflammation recruitment of effectors and t lineage determined tissue damage
Báo cáo y học: "Impact of cytokines and T lymphocytes upon osteoclast differentiation and function" pot
... secreted by, or modulate the activities of, T lymphocytes also affecting osteoclast formation and activity Of interest now and for future studies is the effect of T cells upon osteoblasts and ... highlighted the interdependence between T cells, osteoblasts and osteoclasts This is particularly crucial in the pathogenesis of rheumatoid arthritis, with several cytokines and growth factors that ... promote osteoclast formation The essential role of T lymphocytederived RANKL in rodent models of arthritis has been identified through adoptive transfer experiments that highlight the essential...
- 3
- 272
- 0
Báo cáo y học: "T-cell senescence and contraction of T-cell repertoire diversity – catalysts of autoimmunity and chronic inflammation" pdf
... T- cell compartment, which is the primary contributor to TCR diversity, was affected in addition to the memory T cells Contraction of diversity in the naive T- cell compartment could not be attributed ... Irrespective of the primary defect, these data suggest that patients with RA have a history of increased homeostatic proliferation of naive T cells that predated their disease, The immune system ... is, at most, 5% of the capacity that existed at the age of 20 years [5,26] Consequently, the need for the replenishment of naive T cells must come from the autoproliferation of existing T cells...
- 10
- 412
- 0
Báo cáo y học: " Inhibitors of inflammation and endogenous surfactant pool size as modulators of lung injury with initiation of ventilation in preterm sheep" ppt
... group We took advantage of this variable injury to demonstrate that the amount of Sat PC in the BALF at autopsy was associated with the amount of lung inflammation and injury There appears to be ... IL-1 and IL-8 signaling These studies, in combination with our previous study with postnatal corticosteroid treatment, suggest that blockade of proinflammatory responses to the initiation of ventilation ... with FiO2 of 0.4, rate 40 breaths/min, and inspiration time of 0.7 sec (Bournes BP200) without surfactant treatment Lambs received ventilation without PEEP and with tidal volume (V T ) targets...
- 8
- 371
- 0
Báo cáo y học: " Change in CD3 positive T-cell expression in psoriatic arthritis synovium correlates with change in DAS28 and magnetic resonance imaging synovitis scores following initiation of biologic therapy-a single centre, open-label study" doc
... all patients At the time of enrolment, each patient had to have a diagnosis of PsA for at least three months, and at least three tender and three swollen joints (one of which was a knee), of a ... both at all time points in the study and when comparing the changes with treatment No relationship was found in this cohort between ΔMRI synovitis and ΔDAS28 The fact that this MRI data reflects ... not found after etanercept treatment in the present study, and may be related to the difference in mechanism of action between the anti-TNF antibodies compared to etanercept [38] Only two previously...
- 10
- 358
- 0
Role of hodgkin and reed sternberg cell derived lymphotoxin alpha in t cell recruitment into the microenvironment of hodgkin lymphoma lesions
... JAK-STAT signaling is often somatically mutated and inactivated in cHL (Joos et al., 2000; Mottok et al., 2007; Weniger et al., 2006) Besides genetic mutation, constitutive activation of JAK-STAT ... Introduction In contrast, TEF and TEM subsets not express CCR7 and negligible or low expression of L-selectin TEF and TEM subsets not migrate into PLN (Sallusto et al., 1999) Both TEF and TEM ... is tightly linked to TNF The human LT gene consists of exons and introns The position of LT and TNF within the MHC gene locus is very unique It has been shown that LT can exist in at least different...
- 204
- 400
- 0
RECRUITMENT OF CLERKS AND PROBATIONARY OFFICERS pot
... caste / tribe certificate (for SC/ ST candidates) and completion of all other pre recruitment formalities to the complete satisfaction of the Bank Further, such appointment shall also be subject ... password Candidates shall retain the printout of the online application with them (vii) There will not be any provision to modify the submitted online application Candidates are requested to take utmost ... right to allot the candidate any of the centres other than the one opted for by him/ her, to advance/ postpone / reschedule the interview dates and/ or to add or delete or modify/ change the centre...
- 6
- 300
- 0
Báo cáo khoa học: DNA mediated disassembly of hRad51 and hRad52 proteins and recruitment of hRad51 to ssDNA by hRad52 pot
... question Our results suggest that transient contacts of DNA strands with either protein create an effect of ‘protein disaggregation’ It is important to note that all the effects uncovered in the ... GCCTGCAGGTCGACTCTAGAGGATCCCCGGGTAC CGAGCTCGAATTCGTAATCATGGTCATAGCTGTTT CCT—3¢ DNA concentrations are expressed as total nucleotide concentrations The oligonucleotide used in the current study was ... Piscataway, NJ, USA) DNA substrate Dynamic light scattering The sequence of the 121-mer ssDNA substrate PUC+, used in this study was: 5¢—TTTCCCAGTCACGA CGTTGTAAAACGACGGCCAGTGCCAAGCTTGCAT GCCTGCAGGTCGACTCTAGAGGATCCCCGGGTAC...
- 9
- 378
- 0
Báo cáo khoa học: Alternative initiation of transcription of the humanpresenilin 1gene in SH-SY5Y and SK-N-SH cells The role of Ets factors in the regulation ofpresenilin 1 pptx
... Effect of PS1 promoter point mutations on the efficiency of transcription initiation and 23 the position of the start site(s) (A) Effect of point mutations in Ets and Sp1 motifs on PS1 promoter activity ... that the double mutant at +90 and +129 resulted in activity comparable to wild type promoter, hence the double mutation appears to reverse the effect of either of the single mutations alone These ... of wild type The probe containing a mutation at +165 was generated by substituting p27m (5¢-gat ctctagaCGGTGCCTGACTGGCTTGC-3¢) p27 instead of Results Differential effect of 5¢ -and 3¢-deletions...
- 10
- 492
- 0
Báo cáo khoa học: Initiation of JC virus DNA replication in vitro by human and mouse DNA polymerase a-primase ppt
... established that the species specificity of lytic infection by the polyomaviruses SV40 and PyV is determined at the level of DNA replication both in vivo and in vitro by the nature of the host ... acetate, mM EGTA (pH 7.8), mM ATP, 0.3 mM CTP, GTP, and UTP, 0.1 mM dATP and dGTP, 0.05 mM dCTP and dTTP, 40 mM creatine phosphate, and 80 lgÆmL)1 creatine kinase, and lCi each of [a32P]dCTP and ... ultimately determine the restriction of virus propagation to a particular host For SV40 and PyV these are, respectively, the p180 and p48 subunits of DNA polymerase a-primase in initiation of...
- 8
- 326
- 0
Báo cáo khoa học: Tec family kinases Itk and Rlk⁄ Txk in T lymphocytes: cross-regulation of cytokine production and T-cell fates pot
... that both cytokine and TCR signaling may affect regulatory T- cell differentiation, it will be of interest to see the role of the TFKs in regulating the differentiation of this subset Together, these ... pathways In this regard, the TFKs have come to the light for their roles as potential regulators of cytokine production downstream of TCR stimulation Such studies reveal that mutation of the TFKs ... Mutation of Itk prevents full activation of Ca2+ mobilization and ERK activation – these defects are worsened by mutation of both Rlk ⁄ Txk and Itk [8] Mutations affecting Itk also affect TCR-driven...
- 10
- 312
- 0
Báo cáo khoa học: Human papillomavirus 16 E7 protein inhibits interferon-c-mediated enhancement of keratinocyte antigen processing and T-cell lysis docx
... forward, 5¢-ACC TGG CTA CGG TAC ACC TG-3¢; TAP1, reverse, 5¢-CCT CTG AGC TCC CAC TTG AC-3¢; IRF-1, forward, 5¢-CCT GGG TCA GGA CTT GGA TA-3¢; IRF-1, reverse, 5¢-TTC GGC TAT CTT CCC TTC CT-3¢; PA28, forward, ... forward, 5¢-CCG CTC CTC CTT CTC TTT CT-3¢; PA28, reverse, 5¢-AAG CCA AGG TGG ATG TGT TC-3¢; JAK1, forward, 5¢-TCA ACC TTC CCA AAG TGA CC-3¢; JAK1, reverse, 5¢-CAT GAC TCG CTG CAT GAA CT-3¢; PIAS1, ... impairment of IFN-c-induced enhancement of presentation of endogenous antigen to CTLs For E7-KCs, IFN-c treatment is less able to enhance the transcription of genes regulating antigen presentation,...
- 9
- 352
- 0
Báo cáo khoa học: Cytoskeleton-modulating effectors of enteropathogenic and enterohaemorrhagic Escherichia coli: Tir, EspFU and actin pedestal assembly pdf
... EPEC Tir possesses Nck-independent activities that influence actin pedestal formation It is important to note that Tir activities other than Nck recruitment may influence the maintenance or architecture ... factors may interact with EspFU [62], suggesting that they are not mere bystanders during EHEC infection of host cells Thus, the ability of EspFU to alter the activity of these proteins or upset ... [25,26] Not surprisingly, given the essential roles of intimin and Tir in intimate cell attachment, bacterial mutants that lack intimin or Tir not colonize the intestine and are avirulent in the murine...
- 13
- 154
- 0
Báo cáo khoa học: Cytoskeleton-modulating effectors of enteropathogenic and enterohemorrhagicEscherichia coli: role of EspL2 in adherence and an alternative pathway for modulating cytoskeleton through Annexin A2 function pot
... for reorganization of the cytoskeleton at the adherent site or by modulating cell signaling Environmental stimuli nutrient starvation butyrate etc Regulation and distribution of the espL gene ... clustered at the lipid raft, and is accumulated at EPEC- and EHEC-adherent sites Clustering of Annexin A2 at the EPEC-adherent site is independent of actin pedestal formation, indicating that actin ... multiple copies of the espL2 gene, which does not form intimate attachment via Tir–intimin interaction and can not induce actin polymerization at the site of adherence This clearly indicates that...
- 6
- 272
- 0
Báo cáo khoa học: Cytoskeleton-modulating effectors of enteropathogenic and enterohemorrhagicEscherichia coli: a case for EspB as an intrinsically less-ordered effector pptx
... structure, similar to the tightly packed native state, but lacks tertiary contacts The molten globule state has been considered to be a relatively stable intermediate state that is accumulated ... networks In the future, clarification of the interplay between these effectors and a detailed analysis of EspB in complex with host targets will provide important insight into these interactions ... itself To clarify that the structure of EspB is the native state rather than the folding intermediate, we not use terms such as ‘natively molten globule’ or intrinsically molten globule’, particularly...
- 7
- 333
- 0
Báo cáo khoa học: Translation initiation region dependency of translation initiation in Escherichia coli by IF1 and kasugamycin pdf
... translation initiation, it is not crucial in the in vitro translation system based on purified components, in contrast to the other translation initiation factors IF2 and translation initiation factor ... dependence of translation initiation by IF1 located the antibiotic to the ribosomal tunnel region As the effects of the R40D and the R69L mutations are dependent on the sequence upstream of the initiation ... vivo reporter system We wanted to characterize the determinants of this effect, as they could reveal interactions between the factor and the rest of the translation initiation machinery in the growing...
- 12
- 484
- 0
fundamentals of probability and statistics for engineers - t t soong
... emonstrations of the utility of this material in nonsuperficial applications not only sustain student interest but also provide the student with stimulation to delve more deeply into the fundamentals ... undamentals of Probability and Statistics for Engineers The utility of this result rests with the fact that the probabilities in the sum in Equation (2.27) are often more readily obtainable than the ... description of a random experiment It consists of three fundamental constituents: a sample space S , a collection of events A, B, , and the probability function P These three quantities constitute...
- 408
- 655
- 0
báo cáo hóa học:" In vitro generation of cytotoxic and regulatory T cells by fusions of human dendritic cells and hepatocellular carcinoma cells" docx
... Biosciences) The reactivity of CD8+ T cells to WT1 or CEA or both are shown as the percentage of the total population of CD8+ T cells that were double positive (CD8+pentamer+) Cytotoxicity assays The cytotoxicity ... investigated whether supernatants derived from the HCC cells affect the function and maturation of DCs The data show that exposure of immature DCs to the supernatants results in down-regulation of ... supernatants in the generation of Treg in vitro is demonstrated in the present study, little is known about the impact of fusion cell vaccination on generating Treg The negative impact of fusion...
- 19
- 459
- 0
Báo cáo hóa học: "Quantification of newly produced B and T lymphocytes in untreated chronic lymphocytic leukemia patients" ppt
... lymphocytes, that of naive Th cells, Treg, TEM and TCM after gating on Th cells, and that of thymicnaive Th cells after gating on naive Th cells The percentage of thymicnaive Treg is obtained after ... estimate of the amount of newly produced B and T lymphocytes [8,9] Here, we applied the new assay, together with the flow cytometry, to quantify the number of recently produced B and T cells and ... for this study LI, MM, LC and GR wrote the manuscript and participated to the discussion All authors read and approved the final manuscript Page of Competing interests The authors declare that they...
- 7
- 559
- 0
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc
... cell transplantation (HSCT) Studies in such patients indicate that Treg cells increase in response to the treatment, and that this effect seems to be increased with prolonged time of treatment [66] ... potential limitation of the process is the identification of those antigens that are the most relevant as targets, as the human auto-antigen-specific T cell repertoire is diverse and the optimal ... contribute to the onset of T1 D [53] These results suggest that an IL-2 functional deficiency in the target organ may disturb the positive feedback loop that controls Foxp3 stability, such that Treg...
- 12
- 573
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25