in the choose fields dialog box click check box of the fields for which you want to create a slicer
No Safer Place in the World for Your Money - How to Make Sure All Your Deposits Are Protected by FDIC Insurance docx
... Prepaid cards are also marketed as alternatives to traveler’s checks, especially for international travel, and as a way for parents to give an allowance to their children They also are being ... (start using) the card, add money onto the card, make purchases, withdraw cash, inquire about your balance at an ATM (that’s in addition to any fee charged by the company that operates the ATM you ... different payment scenarios The calculator can also help you develop a plan for paying off your balance sooner Find it at www.federalreserve.gov/ creditcardcalculator A Spanish version is available at...
- 8
- 725
- 0
What to look for when you want to invest in a company by geoffrey byruch
... representative of the company If they are not, then not invest If they are, then continue your research Certain questions you want to ask are: • Do you share the same vision and goals of the CEO of the ... Looking at its annual history of its net income and profit margins will be a sufficient amount of information to make your decision to invest TALK TO A LAWYER OR FINANCIAL ADVISOR • If you were ... important steps you can take in holistically viewing your company on a financial basis NET INCOME, REVENUE, COST, PROFIT MARGINS • Begin by analyzing this in parts Start off by analyzing the revenue...
- 12
- 327
- 0
A STUDY ON THE ENGLISH VIETNAMESE TRANSLATION OF TERMS IN THE MATERIALS FOR MECHANICAL ENGINEERING
... technical translation, so it plays an important role in the development of Mechanical Engineering The thesis studies the English – Vietnamese translation of terms in the materials for Mechanical ... terms in materials for mechanical engineering Hopefully, the result of the study would be useful in technical translation especially translation in mechanical engineering, dictionaries editing, ... to finds out appropriate Vietnamese equivalents for the English terms The thesis aims to draw out common translation strategies which can be applied in the English-Vietnamese translation of terms...
- 2
- 855
- 9
A STUDY ON THE ENGLISH VIETNAMESE TRANSLATION OF TERMS IN THE MATERIALS FOR MECHANICAL ENGINEERING
... is an international language; it is used in almost fields, in many materials, and on various media Therefore, the EnglishVietnamese translation particularly mechanical engineering term translation ... equivalent textual material in other language (target language)” Hartman and Stork (1972:713) also give a similar definition of translation, “translation is the replacement of a representation of ... through-translations are the names of international organizations which often consist of universal words which may be transparent for English and Romance languages, and semantically motivated for Germanica and...
- 43
- 1,061
- 2
Tài liệu Engineering Mechanics - StaticsChapter 1Problem 1-1 Represent each of the following combinations of units in the correct SI form using an appropriate prefix: (a) m/ms (b) μkm (c) ks/mg (d) km⋅ μN Units Used: μN = 10−6N kmμkm = 109−6Gs = 10 s pptx
... resultant force is to be F1, directed along the keel aa as shown, determine the magnitudes of forces T and P acting in each rope and the angle θ of P so that the magnitude of P is a minimum T acts ... - Statics Chapter Problem 2-27 The beam is to be hoisted using two chains Determine the magnitudes of forces FA and FB acting on each chain in order to develop a resultant force T directed along ... subjected to known forces, as shown, determine the orientation θ of the third chain,measured clockwise from the positive x axis, so that the magnitude of force F in this chain is a minimum All forces...
- 1,119
- 1,071
- 2
Tài liệu Báo cáo khoa học: Moult cycle-related changes in biological activity of moult-inhibiting hormone (MIH) and crustacean hyperglycaemic hormone (CHH) in the crab, Carcinus maenas From target to transcript ppt
... GTTGAGATCTGTTGTTTACTTCTTC GAGTTATCAACGACGAGTGTCC GAGACGACAAGGCTCAGTCC AAAGGTTTCCTCCACCCTGT ACTTCCTCGAGCTTGTCACG GACTTGGAGCACGTGTGT TATTGGTCAAACTCGTCCAT AAGACAGGAATGGCGAGT AATCTCTCAGCTCTTCGGGAC AAACGGTCACCCTCCTTGA ... membranes This was not due to stochastic variations in binding kinetics, as YO membranes from C4 animals were always run in parallel, to compare other experiments, and similar increases in Bmax for ... 30 Kotlyar, S., Weirauch, D., Paulsen, R.S & Towle, D.W (2000) Expression of arginine kinase enzymatic activity and mRNA in gills of the euryhaline crabs Carcinus maenas and Callinectes sapidus...
- 9
- 587
- 0
So, you want to go to grad school in Economics? A practical guide of the first years (for outsiders) from insiders pptx
... In this way you can work together and learn the material together, and take advantage of comparative skills Remember: The important thing is to learn, not to finish the race in time for the next ... covered These are your main objective in the first year (after learning all the material, of course) Instructors don’t care if you got an A+ or a C- as long as you These are also known as core examinations, ... suffering in the first year Besides the professors, the TA’s of the courses you are taking in your first year are also an important part of the first year life Don’t hesitate to talk to them Go to their...
- 12
- 696
- 0
Global Environmental Health in the 21st Century: From Governmental Regulation to Corporate Social Responsibility ppt
... of the National Academy of Sciences The National Academy of Engineering was established in 1964, under the charter of the National Academy of Sciences, as a parallel organization of outstanding ... is prepared in the form of a workshop summary by and in the names of the editors, with the assistance of staff and consultants, as an individually authored document International Standard Book ... such as the tsunami in Indonesia, hurricanes Katrina and Rita in the Gulf Coast, and SARS There is a need for stakeholders to bring their expertise to the table In this workshop, the Institute of...
- 127
- 389
- 1
CREATIVE ACCRUAL ACCOUNTING IN THE PUBLIC SECTOR: ‘MILKING’WATER UTILITIES TO BALANCE MUNICIPAL BUDGETS AND ACCOUNTS pot
... Sociological Paradigms and Organizational Analysis (Heinemann, London) Carlin, T (2005), ‘Debating the Impact of Accrual Accounting and Reporting in the Public Sector’ Financial Accountability & Management, ... application of accrualbased accounting and financial reporting, including an income statement, a comprehensive balance sheet and a statement of financial inflows and outflows The driving forces behind ... Secondly, the heading ‘Compensation for the Basic Capital’ misleads rather than helps the reader to understand the financial information of Water Utility: she or he may assume that the item is equal to...
- 20
- 640
- 1
Báo cáo Y học: Guanosine diphosphate-4-keto-6-deoxy-D-mannose reductase in the pathway for the synthesis of GDP-6-deoxy-D-talose in Actinobacillus actinomycetemcomitans potx
... introduce appropriate restriction sites for subcloning: to subclone the gmd gene into the vector pIVEX2.3, 5¢-CGCG CCATGGTGAAAACAGCAATTGTAACT-3¢ (NcoI) and 5¢-GCGCCCCGGGAAAAGAAAAACC-3¢ (SmaI); and to ... ultrasonication The cell extract was obtained by centrifugation at 20 000 g for 30 at °C Binding of the fusion proteins to chitin beads via the intein/ chitin binding domain, cleavage of the fusion ... (serotype a) contains 14 ORFs (Fig 2A) A protein database search was performed with the programs FASTA [37] and BLAST at the National Institute of Genetics, Mishima, Japan The products of 11 genes,...
- 9
- 625
- 0
Báo cáo khoa học: Autoregulatory binding sites in the zebrafish six3a promoter region define a new recognition sequence for Six3 proteins potx
... absence of Arg5 in their N-terminal arms may explain, in part, why regulatory DNA sequences that bind Six1 ⁄ and Six4 ⁄ not contain the TAAT core [17] Although the Six3 ⁄ proteins also lack Arg5, their ... Vertical bars (numbered 1–18) indicate ATTA motifs in the forward strand Vertical bars indicate 25 ATTA motifs in the reverse strand, and the four GNNATTA sites in the reverse strand are labelled ... chromatin was isolated The isolated chromatin was sonicated to an average size of about 300 bp Incubation with normal goat IgG precleared the chromatin Protein G magnetic beads were incubated...
- 15
- 349
- 0
does sexual harassment still exist in the military for women
... south-east Asia and increasingly frustrated by a losing war, a whole generation of naval officers began carousing in the sleazy bars of Bangkok and the Philippines The Vietnam vets and the exploitativesexual ... The Navy has made a strong and thoughtful effort towards the declining of sexualharassment since the Tailhook scandal In fact, all the services have Beginning this year, equal opportunity training ... exploitativesexual attitudes they developed in Asia arrived home in the 70's just as women were beginning to move into the ranks This resulted in a declining of manner and morals with the arrival of female...
- 3
- 225
- 0
china in the 21st century what everyone needs to know apr 2010
... provide a name for the country, the name of the following dynasty was taken as the name for the land’s inhabitants The majority population of the PRC is dubbed the “Han,” and of cial statistical counts ... it was quoted at the start of the Beijing Games The line, which was CHINA IN THE 21ST CENTURY quoted again by a young man who put a question to President Obama during the Shanghai “town hall” ... Chinese wanted to buy in comparably significant quantities, a trade imbalance favoring China developed, leading to the flow of silver out of the West and into the Qing Empire To counteract this (and to...
- 187
- 544
- 0
Báo cáo hóa học: "The density of macrophages in the invasive front is inversely correlated to liver metastasis in colon cancer" docx
... regulate pulmonary metastasis of mammary carcinomas by enhancing protumor properties of macrophages Cancer Cell 2009, 16(2):91-102 48 Mantovani A, Sica A, Allavena P, Garlanda C, Locati M: Tumor-associated ... P, Torri V, Repici A, Santoro A, Mantovani A, Roncalli M, Malesci A: CD3+ cells at the invasive margin of deeply invading (pT3-T4) colorectal cancer and risk of post-surgical metastasis: a longitudinal ... 43(9):1348-1360 Shah A, Alberts S, Adam R: Accomplishments in 2007 in the management of curable metastatic colorectal cancer Gastrointest Cancer Res 2008, 2(3 Suppl):S13-18 Shrivastav A, Varma S, Saxena A, ...
- 9
- 828
- 0
Báo cáo hóa học: " Risk factors for low birth weight in Botucatu city, SP state, Brazil: a study conducted in the Public Health System from 2004 to 2008" pptx
... study revealed a reduction in the adequacy indexes for both groups according to the increase in coverage of the indicator used The increase in inadequacy as a result of the modified Kessner Index ... cities in the country This regional difference has been currently attributed to the availability of prenatal and perinatal care rather than to social condition The latter was the main cause of low ... significant and no variable included in the analysis had more than 20% of missing data Distribution of maternal gestational and delivery characteristics as well as those of newborns according to the...
- 18
- 422
- 0
prevalence and influencing factors of the lower reproductive tract infections among sex workers in the centre for treatment - education- labour ii hanoi and evaluation of the intervention
... by other strains Candidas Albicans is also causing fungal diseases in many organs such as the skin and mucosal infections, Septicaemia, endocarditis, meningitis The incidence in Haiphong province ... staff of the Centre 2.2.3.1.2 Clinical examination Clinical exam to identify the symptoms of LRTsI Take exam to detect the exsisting STDs: genital ulcer, urethral and vaginal discharge, stinking ... was reasonable, because in fact in Vietnam, the FSW in streets were older than FSW in restaurants, no longer able to attract clients and have to relocate their whored place In Thailand, India,...
- 14
- 527
- 0
Báo cáo y học: "Joining forces in the quest for orthologs" ppsx
... this dataset will be available very soon Rolf Apweiler (European Bioinformatics Institute, Hinxton, USA) offered that UniProt maintain the set Regarding the need for standardized input and output ... many requests and making sure we ran on time, to all participants in the meeting for their valuable ideas, and to Michael Ashburner from whom the idea for this valuable workshop also originated ... recognized the usefulness of multiple and at times contradictory criteria, but also the need for a common understanding on their usage and interpretation Finally, we agreed that adopting a common dataset...
- 3
- 294
- 0
báo cáo khoa học: " Implementation of case management to reduce cardiovascular disease risk in the Stanford and San Mateo Heart to Heart randomized controlled trial: study protocol and baseline characteristics" pps
... measured in both arms, using the brachial artery, after 10 minutes of sitting in a relaxed position, and the average of two readings was used After ascertaining that the patient had fasted for ≥ ... containing basic information about cardiovascular disease and a risk factor description sheet listing their biophysical measurements recorded at the baseline appointment as well as the ideal values ... (1) to perform the testing of the secondary hypotheses related to moderators and mediators of the intervention effect For example, these covariates may include SES, change in caloric intake, and...
- 12
- 508
- 0
báo cáo khoa học: " ’It’s risky to walk in the city with syringes’: understanding access to HIV/AIDS services for injecting drug users in the former Soviet Union countries of Ukraine and Kyrgyzstan" ppt
... study and analysis and interpretation of data AH contributed substantially to the analysis and interpretation of data All authors participated in manuscript writing and have read and approved the ... explanatory insights into the problems of accessing HIV/AIDS services The aim was to develop a better understanding of the nature and complexity of factors that obstruct access rather than to measure ... ‘ they “plant” heroin, accuse you of a crime I was arrested last year ’; ‘ they start beating at once and force you into the car ’; ‘ there is an example when heroin was planted to one of the...
- 15
- 477
- 0
Báo cáo y học: "Prediction of prognostic biomarkers for Interferon-based therapy to Hepatitis C Virus patients: a metaanalysis of the NS5A protein in subtypes 1a, 1b, and 3a" doc
... databases Associative classification aims to discover a small set of rules in the database, called class association rules, to form an accurate classifier The accuracy of the rules is measured by their ... roots in machine learning Associative classification aims to detect relationships between categorical variables and large datasets This enables identification of hidden patterns in large databases ... Ali Khalifa, Mona Kamar, and Nafisa Hassan for their efforts and help through this paper Author Details 1Informatics and Systems Department, Division of Engineering Research, National Research...
- 9
- 213
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25