in such flowers the dorsal sepal was absent and the flowers failed to open fully fig 3 6b at 15 days after anthesis nuclei with up to 8c dna content were detected in all the tissues of the defo
Transport and fate of persistent toxic organic chemicals in aquatic ecosystems: the Niagara River to St Lawrence River Estuary example pptx
... found in Allan (1989a) The role of the atmosphere The air-water interface involves the atmosphere as both a source of PTOCs and waterways as a source of PTOCs to the atmosphere Water bodies such ... detect PTOCs in Lake Ontario have been predator fish and the eggs of fish-eating herring gulls In these media, PTOCs often in the ppm or high ppb range PTOC concentration trends in most predatory ... between the concentration of a PTOC in the particulate phase and the concentration in solution is complicated by several factors At a given particulate concentration, the concentration of the chemical...
- 12
- 650
- 0
DSpace at VNU: L2 Learners’ Reading Problems in Terms of the Factors Relating to Their Meta-Knowledge of English Information Structure
... questionnaire and the reading tests, interviewing them to validate the information obtained in the questionnaire, analyzing information in the questionnaire, the interview and the tests to get clues for update ... English proficiency, learners’ motivation and interest, and the features of their reading that need to be investigated, and the equivalence in the levels of difficulty The contents of the reading passages ... it was the main idea that helped them to understand the text, reading from beginning to end was a waste of time because there was information they did not really need, it was difficult to get the...
- 21
- 143
- 0
Báo cáo y học: "Chromatin and siRNA pathways cooperate to maintain DNA methylation of small transposable elements in Arabidopsis" ppsx
... sequencing shows a reduction of methylation at one flanking MspI site in cmt3 and at the other flanking MspI site in drm1/2 (Figure 4b,c; Table 3) Interestingly, a reduction in methylation at the ... sequencing data derived from [10,29] 11SIN3-111 93 is a SINE3 element located between At3 g22060 and At3 g22070 12229R1 and 229R2 are intergenic sequences within kb of one another located between At1 g36940 ... sequencing SIN3-111 93 (A0111 93) G->A: 5'-CCTCCTTCGTTGACCTGTCTTCATCGCAATGACTCAGCATAG -3' C->T: 5'- GTCTTCTAATCAAGTTTAGTTATGTTAATGTTTTTGGATAGAAC -3' SIN3- 530 0 (A00 530 0) G->A: 5'-TTCATTTGTTACCTACTATCATTTTCAAGAACGAAACAATG -3' ...
- 11
- 313
- 0
Báo cáo y học: "Parvovirus B19 Genotype Specific Amino Acid Substitution in NS1 Reduces the Protein’s Cytotoxicity in Culture"
... Expression of NS1 in primary hepatocytes as well as in HepG2 cells was shown to be cytotoxic (34 ) Activation of the innate apoptotic cascade was demonstrated to be the route of cell demise in the setting ... livers of two patient groups; group A contained patients with idiopathic fulminant hepatitis while group B was made up of patients with biliary atresia The study correlated the presence of genotypes ... cell death To test the hypothesis that B19-associated liver pathology is related to the direct toxicity of persistent B19 NS1 in hepatocytes of previously infected individuals, we examined the possible...
- 10
- 554
- 0
HIV infections rise in women of the Mekong
... em theo phong trào to n cầu, “Một lời hứa tiếp tục gìn giữ” Hà Anh Newspaper : Phap Luat va Xa Hoi (Laws and Society) Date : December 5, 2012 Page/Link : http://phapluatxahoi.vn/2012120511061 737 5p1001c1051/phu-nu-mang-thaitre-em-nhiem-hiv-phai-duoc-chu-y-dieu-tri-hon.htm ... December 1, 2012 Page/Link : http://giadinh.net.vn/20121 130 110 835 319p0c1000/phu-nu-mang-thai-va-treem-nhiem-hiv-can-duoc-dieu-tri.htm HIV+ pregnant women and children need treatment Phụ nữ mang thai ... Newspaper : VN Express Date : December 1, 2012 Page/Link : http://vnexpress.net/gl/suc-khoe/2012/12/nhung-nan-nhan-vo-toi-cua-hiv/ The innocent victims of HIV Những nạn nhân vô tội HIV...
- 6
- 503
- 1
Using games for the 10th form speaking clas in high school (the new textboook) = sử dụng trò chơi trong giờ học nói tiếng anh lớp 10 ở trường trung học phổ thông SGK mới
... the teachers and students there Investigating and analyzing the results gained from the survey about the current situation of teaching and learning speaking skills and using games in speaking ... achievement of the thesis and suggests some extensive topics relating to the thesis The study ends up with "References" with a list of sources of materials and "Appendix" with the questionaires of the ... she has to remain in charge and keep the situation under control all the time The teacher acts as the role of monitor, and resource center, moving from group to group, listening, supplying and necessary...
- 59
- 2,358
- 5
Some register features in agreement between the united states of america and the socialist republic of vietnam on trade relations = một số đặc điểm ngữ vực trong hiệp định thương mại việt mỹ
... renovation cause and to raise its economy's competitiveness on the one hand, and on other hand to affirm the consistency of the Party and State's policies to integrate the national economy into the ... piece of discourse under analysis The later includes the type of communicative event, the topic, the purpose of the event, the setting, the xii participant and the relationships between them and the ... understand the nature of globalization and international integration, as well as WTO’s rules Vietnam's commitments to the BTA are similar to those to the WTO Therefore, the implementation of the BTA...
- 48
- 568
- 5
Một số đề xuất cho bài điều tra trên báo in theo cách thể hiện của báo chí hiện đại
... liệu sau: Đơn vị: tin, Thể loại Điều tra Báo TTTP.HCM Thanh niên Tổng Bài phản 38 42 80 ánh 35 39 74 Tin 29 40 69 Pháng vÊn ThĨ lo¹i Tỉng 30 35 68 khác 25 40 62 157 196 35 3 Bảng thống kê số lợng ... Linkton (Singapore) trúng thầu cung cấp điện kế điện tử pha (do Công ty Linkton sản xuất Singapore) pha (do Công ty Linkton mua Công ty EDMI) cho Công ty Điện lực TP.HCM (CTĐLTP) Công ty Linkton ... dự thầu, Linkton Singapore ® a cam kÕt lµ cung cÊp ®iƯn kÕ điện tử (ĐKĐT) nhập từ Singapore cho Công ty Điện lực TP.HCM (CTĐLTP) Thế nhng sau kết đấu thầu, CTĐLTP lại mua ĐKĐT Linkton Vina lắp...
- 70
- 433
- 1
Developing a system of exercises to improve public speaking skill in interpreting for the 4th year students of english at vinh university
... a kind of interpreting in which interpreter and speaker are sitting together in the same location with an audience In this type of interpreting, the interpreter begins their interpretation of ... activities, and the role of an interpreter is arguably one of the oldest of professions” He finds out the way of interpreting is orally and emphasizes the position of interpreting and the interpreter in ... of paying attention to what speaker say and trying to work out what they mean” (1989:144) Listening is the combination of two phases: hearing (listening enough to catch what speaker saying) and...
- 71
- 689
- 1
Tài liệu The importance of land tenure in African countries: The case of Uganda doc
... quay vòng chất dinh dưỡng, ngưng kết chất nitơ, quản lý sâu bệnh thống v.v.), đặc biệt sử dụng tốt tri thức kỹ người nơng dân tăng cường tự tin khả họ Định nghĩa Smyth Dumanski (19 93) SLM là: “Quản ... nghiệp tài nguyên thiên nhiên phát triển nông thơn Từ năm 20 03, Cơ sở mơi trường tồn cầu (GEF) sáng lập chương trình tác nghiệp (OP 15) cho Quản lý đất đai bền vững Quản lý đất đai bền vững (SLM) ... đa dạng xã hội giới, 2) thể chế, luật lệ ững xử, 3) tác nhân, 4) tham gia, 5) rủi ro xã hội (Sách nguồn phân tích xã hội, Ngân hàng Thế giới, 20 03) Tất điểm phù hợp với công tác quản lý đất đai...
- 6
- 825
- 0
Tài liệu Hyperlink from a Row in the Data Grid to a Detail Page ppt
... txtUnitPrice Add the code in Listing 5 .31 to the Load event of the page In the SQL select statement created in this listing, the Request.Item is used to grab the productID that was passed from the first ... same in step Add the code in Listing 5 .30 to the Load event of the page Listing 5 .30 wfrmHowTo5_8a.aspx.vb: Filling and Binding the Products to the DataGrid Object Private Sub Page_Load(ByVal sender ... the Columns tab and set the properties as displayed in Figure 5.14 Be sure to note the name of the form you are calling in the URL Format String so that you can name it the same in step Add the...
- 5
- 392
- 0
Tài liệu Developing Regional Bond Markets In East Asia: The Way Forward ppt
... material presented at the Voluntary Working Group Meeting of the Asian Bond Market Initiative, June 16, 20 03, Tokyo scale by pooling the funding needs of schemes have to be examined carefully Asian borrowers ... What would be the structure and characteristics of these markets, if Asian investors as well as by global investors they are to be designed to serve the needs of both borrowers and Rationale and ... monetary and financial The PECC Finance Forum undertook a cooperation to prevent recurrence of study of these issues in 20 03 and future crises Recently, developing discussed the findings from...
- 5
- 373
- 0
THE FIRST YEAR – LANGUAGE STUDENTS’ DIFFICULTIES IN PARAGRAPH WRITING AND SOME APPROPRIATE STRATEGIES TO SOLVE THESE PROBLEMS AT THE NATIONAL ECONOMICS UNIVERSITY
... like using pictures and using readings with various activities such as working with the text using copying, working with the text to examine cohesive links, working with the text to combine sentence, ... errors in organization and errors in language First of all, errors in content are all the errors that show the students’ lack of understanding the paragraph content and meaning These include the ... need to spend the majority of their time on this stage of the writing process to read again and again in order to find out and edit their writings better, that will be easy for them to remember the...
- 61
- 1,410
- 4
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008