image 2 in the properties of the bitmap object and this time select the green traffic light image called traffic g s jpg set its value property to 1
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf
... set designed from a published sequence (GenBank accession number P30 519 ) (sense, 5¢-AGATCTATCCCTT GAGGCCTTGTCCGCTTG-3¢; antisense, 5¢-AAGCTTG CC GCAGGTCGCTGTCGCCTG-3¢; these contain a BglII site ... expression levels of HO -1 protein in these cell lines under hypoxia In contrast, the expression levels of HO -1 mRNA and protein were consistently decreased in HeLa and HepG2 cells Interestingly, ... several sequence motifs for binding of transcription factors, such as Sp1 Incidentally, the HO -2 gene and the gene encoding HSCARG of unknown function (GenBank acces- FEBS Journal 27 3 (20 06) 313 6– 314 7...
- 12
- 621
- 0
báo cáo hóa học:" In vivo properties of the proangiogenic peptide QK" pdf
... Altobelli GG, Cimini V, Galasso G, Astone D, Piscione F, Pastore L, Trimarco B, Iac- 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 carino G: The G- protein-coupled receptor kinase inhibits NFkappaB ... VEGF-induced signaling cascades and stimulate angiogenesis in vitro [9] This is the first report to show that this peptide is able to recapitulate the in vivo responses of VEGF Angiogenesis is known to ... in aqueous solution [11 ] that resembles the 17 25 α-helical region of VEGF165, and binds both VEGFR -1 and The main purpose of this study is to evaluate in vivo the effects of this de novo engineered...
- 10
- 679
- 0
báo cáo hóa học:" Expression of Bone Morphogenetic Protein-2 in the Chondrogenic and Ossifying Sites of Calcific Tendinopathy and Traumatic Tendon Injury Rat Models" doc
... 5'-TAGTGACTTTTGGCCACGACG-3' Reverse: 5'-GCTTCCGCTGTTTGTGTTTG-3' Forward: 5'-ATCGTGGGCCGCCCTAGGCA-3' Reverse: 5' TGGCCTTAGGGTTCAGAGGGG-3' 58°C β-actin expression of the operated limb to the control ... Activities of BMPs are inhibited extracellularly by BMP-binding proteins such as Noggin and Chordin as well as intracellularly by Smad6, tob and Smurf1 [2] Information on the expression of these osteogenic ... but not in control samples, indicating that BMP -2 might be involved in the pathogenesis of ectopic chondrogenesis and ossification There was also increase in BMP -2 mRNA at week Page of (page number...
- 6
- 291
- 0
Báo cáo khoa học: "Immunohistochemical Localization of Bcl-2 in the Spinal Cords of Rats with Experimental Autoimmune Encephalomyelitis" docx
... cells expressing Bcl -2 not undergo apoptosis [2] Furthermore, the lack of apoptosis in perivascular cuffing in EAE is caused by the generation of superoxide in invading macrophages, at least in ... R0) (Fig 1, lanes and 8) This suggests that Bcl -2 is constitutively expressed in normal adult CNS tissues, and its expression may increase in response to peripheral stimulation, such as immunization ... sclerosis lesions [3] Our findings are further supported by the observation that effector cells, such as oligodendroglial cells expressing many death signals, including Fas, not undergo apoptosis in...
- 5
- 295
- 0
Báo cáo khoa học: "Immunohistochemical study of caveolin-1 and -2 in the rat retina" pps
... noisserpxE PM itnasiL ,SD zthoK ,C uhC ,M lefahC ,S iL ,T otomakO ,Z gnaT ,EP rerehcS ,SK gnoS 41 422 - 12 2 , 62 ,69 91 seR teV J naeroK aniter kcud eht no dica ciniak fo stceffE M miK ,T nihS 31 02- 11 ... eussit traeH snoitcurtsni s rerutcafunam eht ot gnidrocca ,)ASU ,mahsremA( stnegaer ecnecsenimulimehc decnahne gnisu depoleved erew stolb ehT h rof )ASU ,rotceV( GgI esuom-itna detagujnoc-esadixorep ... saw 2- niloevac ,oslA )A3 giF( slessev ni detceted ylesnetni ,revewoh saw gniniatsonummi 2- niloevaC )A3 giF( rekaew hcum saw tub ,1- niloevac fo taht sa emas eht ylegral saw aniter eht ni 2- niloevac...
- 4
- 364
- 0
Báo cáo y học: "Synergistic role of c-Myc and ERK1/2 in the mitogenic response to TGF-1 in cultured rat nucleus pulposus cells" ppsx
... histograms were generated using flow cytometry Each plot represents the analysis of 10 ,000 events The histograms present typical results and the percentage of cells in G0 /G1 , S and G2 /M phases ... Roberts JM: CDK inhibitors: positive and negative regulators of G1 -phase progression Genes Dev 19 99, 13 :15 01- 15 12 Page 11 of 12 (page number not for citation purposes) Arthritis Research & Therapy ... cells (Figure 5b) indicates a large increase in cells in the S phase, associated with the suppression of p 21 and p27 which belong to the Cip/Kip family of cyclin-dependent kinase inhibitors (CKIs)...
- 12
- 535
- 0
Báo cáo khoa học: "Comparative study on the in vitro and in vivo properties of two bovine herpesvirus-5 reference strains" pptx
... virus of unknown, and thus high, number of passages For this strain, no difference in lysis plaque size was observed between passage and the virus of high number of passages used to infect the ... strains of the same alphaherpesvirus previously Despite the fact that the viruses used to perform these assays had the same number of cell culture passages (n = 8), the previous passages to this ... Regarding viral glycoproteins, a role in the anterograde transport of gI, gE and Us9 was suggested in the rabbit model [23 ,24 ] Concerning host factors, the age and immunological status of the animals...
- 8
- 366
- 0
Báo cáo y học: "Comprehensive characterization of the cis-regulatory code responsible for the spatio-temporal expression of olSix3.2 in the developing medaka forebrain" potx
... TCGTCGCCGT ACTGGCTAAT ACTGGCTAAT GATTGGCAGG GATTGGCAGG GATTGGCAGG GATTGGCAGG GATTGGCAGT TGATTGGCAG GATTGGCA-C GATTGGCA-C -483 GC–TGACAGT GC–TGACAGT GC–TGACAGT GC–TGACAGA GC–TGACAGT AGGTGACAGT GCTTGACAGT ... CTCAACATCAGTAACCAACAGGTAAACAGGGGGTAAATTTCGAGGGAGAGGGAGTGAGGGAGGGG ATAATATTCCACCCTCTAATTGCTCATTCCATTCAGCAGATAGGCGAGCATTGGCTTGTGCCTGA TATTATAAGGTGGGAGATTAACGAGTAAGGTAAGTCGTCTATCCGCTCGTAACCGAACACGGACT GCACAAGTGGTGAAAGCCTCGCGCTACGTACTGGCTAATGATTGGCACGCTTGACAGTGATTGGC ... GCACAAGTGGTGAAAGCCTCGCGCTACGTACTGGCTAATGATTGGCACGCTTGACAGTGATTGGC CACGACGTGTTCACCACTTTCGGAGCGCGATGCATGACCGATTACTAACCGTGCGAACTGTCACT AGGGCTGCCATGACAACGCTACAACGACACCAAGAAGACCAATAGAAAAGGGAAACAAAATGTTT TCCCGACGGTACTGTTGCGATGTTGCTGTGGTTCTTCTGGTTATCTTTTCCCTTTGTTTTACAAA...
- 17
- 252
- 0
Plexin a2 and neuropilin 2 in the axonal guidance of cranial nerves in avian embryos
... 50 11 47 13 51 13 46 10 49 10 43 38 44 41 46 14 38 14 55 11 52 11 52 12 38 12 51 10 42 10 50.8 10 .6 43.9 10 .6 4.7 2. 1 4.3 2. 1 shRNA P0.0 01 (Student s t-test) ( indicates level of significance) ... class III semaphorins are the best characterized among the semaphorins They exert their effects by binding with ligand binding neuropilins (Npn -1 and Npn -2) and signal transducing plexins (Fig ... plasmid construct against plexin-A2 and Npn -2 genes The pCAβ-shRNAEGFP vector, co-expressing shRNA and EGFP and the vector based constructs were used (Fig 11 a; Bron et al., 20 04) Eggs were rinsed with...
- 78
- 222
- 0
Tài liệu Unit 2 : in the limelight pdf
... written books PRESENT PERFECT CONTINUOUS An on-going activity I have been cutting the grass The activity started in the past and is continuing after the moment of speaking (so not finished) I have ... rice, and sometimes other INGREDIENTS, cooked slowly in liquid: c m Ý / consist of /kCn sIst Ov/ : (phrasal verb) [transitive] consist of something to be made of particular parts or things: g m ... and early ROCK AND ROLL, containing lively drum beats, repeated electric bass lines, and often singing: / 13 reggae / regeI/ (n): a type of music that developed in Jamaica in the 19 6 0s with songs...
- 8
- 636
- 0
Báo cáo Y học: Differential regulation of the Fe-hydrogenase during anaerobic adaptation in the green alga Chlamydomonas reinhardtii pot
... anaerobically grown cells No Size (bp)a Geneb mRNA (kb)c Differential expressiond 10 11 12 13 14 15 16 17 18 19 20 28 1 3 12 1 92 369 3 01 29 7 23 2 317 18 4 4 12 309 24 3 3 21 27 2 25 1 380 438 384 27 3 19 5 Ribosomal ... (Zea mays L.) responds to anaerobic stress by redirecting the synthetic machinery towards the synthesis of some enzymes involved in glycolysis or sugar-phosphate metabolism [54] HydA belongs to a ... similar to genes encoding proteins of the cytoplasmic ribosome complex The sequences of six clones did not correspond to any entries in the databases Four of these novel clones showed differences in...
- 11
- 469
- 0
Báo cáo khoa học: Kininogen-derived peptides for investigating the putative vasoactive properties of human cathepsins K and L docx
... Results and discussion Processing of HMWK by cathepsins We reported previously that adding kininogen or cystatin to cathepsins results in supplementary bands of digestion on gelatin-containing ... peptides and kinins by hK1 and cathepsins B, L and K (A) Structure of kininogen-derived fluorogenic substrates The sequence surrounding the region of bradykinin insertion corresponds to human kininogens ... normalized as in Fig Gly-Phe bond (Fig 2B), as was Abz-ISLMKRPPGFSP FRSSRI-(3-NO2-Tyr) Although the degradation of kinins is mainly under the control of kininases, such as angiotensin-converting enzyme...
- 8
- 482
- 0
Báo cáo khoa học: "Micronutrients in biomass fractions of holm oak, beech and fir forests of the Montseny massif (Catalonia, NE Spain)" pot
... Heinrichs and Mayer (19 80) for Picea abies forests, suggest a storage function Our results for fir could also be the result of the storage of the less mobile elements in that biomass fraction The stem ... at the foot of a rough mountain slope (30°) The slope in the plot is slight, varying from to 23 °, and the orientation is W and NW The bedrock consists of a metamorphic schist, and the soil is ... percentage of the total amount of these elements if we bear in mind that the leaf biomass is only 3.8% of the total biomass of this forest The percentage of Mn located in leaves is especially high and...
- 8
- 181
- 0
Báo cáo y học: "Association of the T allele of an intronic single nucleotide polymorphism in the colony stimulating factor 1 receptor with Crohn''''s disease: a case-control study" ppt
... (in monocytes) results in inflammatory bowel disease in rodents [22 ,23 ] These data suggest that a signaling pathway involving G alpha i2, Stat3 and CSF1R is critical for protection against intestinal ... walls, and triggers a cascade of signaling events resulting in the activation of NF-kappa B and the host innate immune system [4] NOD2 is expressed in monocytes and in intestinal epithelial cells, ... regarding the expression of the CSF1R protein in the intestine despite documentation of its presence in the epithelium of a variety of other tissues including breast, ovary, endometrium, lung and...
- 8
- 294
- 0
báo cáo khoa học: " Bioaccumulation and toxicity of selenium compounds in the green alga Scenedesmus quadricauda" pps
... phytoplankton species: Page 14 of 16 (page number not for citation purposes) BMC Plant Biology 20 09, 9:58 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 Gymnodinium catenatum, Alexandrium ... to select a strain resistant to high levels of selenate While the resistance to high levels of selenate was successfully attained the strain remained sensitive to high levels of selenite (Figures ... active selenide for the synthesis of selenoproteins and is an important protector of cells against Se toxicity [26 -28 ] Besides the presence of selenium in selenocysteine, selenium can substitute sulfur...
- 16
- 410
- 0
Báo cáo y học: "Mutagenesis of tyrosine and di-leucine motifs in the HIV-1 envelope cytoplasmic domain results in a loss of Env-mediated fusion and infectivi" pps
... 5’GCCTGTGCCACTTCAGCTCCCACCGC3’, LY768HSRP - 5’GCGGTGGGAGCTGAAGTGGCACAGGC3’, L7 71/ LLLI774SHSSFP - 5’GCTCCCACCGCTCGAAAGACTCACACTCGAATGTAACGAGG3’, L7 71/ LLLI774SHSSRP - 5’CCTCGTTACATTCGAGTGTGAGTCTTTCGAGCGGTGGGAGC3’, ... 5’CCTGACTCCAAGACTGTTGGTGATTCCACCAAGATTTGAGGGCTTCC3’, LL 814 AAFP - 5’GC TGTTAACGCGGCCAATGCCAATGCCACAGC3’, LL 814 AARP - 5’GGCATTGGCCGCGT TAACAGCACTATTC3’, LL855AAFP - 5’GGGCTTGGAAAGGATTGCGGCATAAGATGGG3’, ... - 5’CGAGGATTGTGGAACTTCTGGGACGCAGGGGG3’, LL784HQRP - 5’CCCCCTGCGTCCCAGAAGTTCCACA-ATCCTCG3’, Y79 5S/ LL799HQ/Y802SFP - 5’GGAAGCCCTCAAACTTGGTGGAATCACCAACAGTCTTGGAGTCAGG3’, Y79 5S/ LL799HQ/Y802SRP -...
- 17
- 362
- 0
The Role of Law in the Green Economy Challenges and Opportunities for the Liberalization of Environmental Goods and Services
... integration measures, in the sense of using trade to promote important goals of sustainable development such as the transition to a green economy and the fight against climate change These measures include ... have progressively integrated the promotion of this goal, including green economy‒related issues such as liberalization of EGS The analysis in this section focuses on four EU agreements that provide ... “kick-starting” financing for the green economy, as well as in creating and implementing laws and policies that will guide and support the transition in each sector .2 The concept of the green...
- 16
- 311
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25