ii article xx a and outwardly directed measures
Báo cáo khoa học: "A Statistical Spoken Dialogue System using Complex User Goals and Value Directed Compression" pptx
... knowledge such a combination of goals with different attribute values cannot be straightforwardly handled by comparable state-of-the-art statistical SDSs which appear in the literature Crook and Lemon ... because they have different requirements associated with each, i.e Thai restaurants should be in the centre and cheap, while any French restaurants should be expensive1 and can be located anywhere ... observations, T conditional transition probabilities, Ω conditional observation probabilities, and R is the reward function Since it iteratively projects the rewards associated with each state and...
- 5
- 331
- 0
Báo cáo Y học: Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis ppt
... TGAGAAGTACAATGAGAAGTGTCCGGCAGATA TG-3¢ C17 0A: 5¢-GGCCCTCAAAATGTTCCAGAATT GCTCAGTCGAGGACCTTG-3¢ C-213S: 5¢-CGGTGA AGCGAGCTTATATCTTTTGCAATGAAGATAAAT CATTT-CC-3¢ C25 7A: 5¢GCCAAGGGAAGTTTGCA AGTGCCTGCTTGATATATCAGATT-CA-3¢ ... 2890 E Mattern-Dogru et al (Eur J Biochem 269) CCATAGCTTTGGTGGCATGAGTTTGGG-3¢ S8 7A: 5¢-GTTCTTCTTGGCCATAGCTTTGGTGGCATGAG TTTGGG-3¢ H24 4A: 5¢-CAAAGAAGCAGATCATAT GGGAATGCTTTCGCAGCCAAGGG-3¢ D21 6A: 5¢-G ... diethylpyrocarbonate (DEPC) was from AppliChem (Darmstadt, Germany) All solvents and chemicals were of analytical grade and obtained from Merck (Darmstadt, Germany), Sigma (Deisenhofen, Germany) or...
- 8
- 345
- 0
Báo cáo khoa học: Biochemical and structural analyses of a higher plant photosystem II supercomplex of a photosystem I-less mutant of barley pot
... monomeric antenna proteins (CP26, CP29 and LHCII monomers) (band 2), and tri4620 meric LHCII (band 3), monomeric (band 4) and dimeric (band 5) PSII cores Bands and contained supramolecular complexes ... profile of bands and from the WT and mutant (Zb63) Photosystem I (PSI) core major polypeptides (PsaA and PsaB), ATPase subunits and PSII antenna polypeptides (Lhcb) are indicated, as identified ... mutants However, when we analysed by EM grana preparations from mutant plants grown in LL and HL conditions, we also found that PSII was organized in arrays Lattice parameters were also unchanged,...
- 15
- 476
- 0
báo cáo hóa học: " Population norms and cut-off-points for suboptimal health related quality of life in two generic measures for adolescents: the Spanish VSP-A and KINDL-R" pdf
... non-responses was carried out in Spain As a result, analysis of representativeness showed that, in general, it was acceptable compared to EUROSTAT data regarding age and sex The lower than expected ... VSP -A and KINDL-R were administered together with other demographic and health status variables The VSP -A and the KINDL-R are two generic HRQL measures that were developed in France and Germany ... Assessing health status and quality of life instruments: attributes and review criteria Qual Life Res 2002, 11:193-205 Gandek B, Ware J: Methods for validating and norming translations of health...
- 9
- 557
- 0
báo cáo hóa học: " Pictorial Representation of Illness and Self Measure Revised II (PRISM-RII) – a novel method to assess perceived burden of illness in diabetes patients" pptx
... complications or comorbid diseases) Statistical analysis Means and standard deviation of the various self-report measures were calculated Differences between male and female participants and between ... significantly from one another Results Means and standard deviations for all variables are displayed in Table Type of diabetes Compared to people with type diabetes, people with type diabetes had a ... the statistical analysis and drafted the manuscript AV designed the computerized PRISM-R measure and contributed to the manuscript MdeW contributed to the quality of data management and the manuscript...
- 7
- 410
- 0
báo cáo hóa học:" Pictorial Representation of Illness and Self Measure Revised II (PRISM-RII) – a novel method to assess perceived burden of illness in diabetes patients" pdf
... complications or comorbid diseases) Statistical analysis Means and standard deviation of the various self-report measures were calculated Differences between male and female participants and between ... significantly from one another Results Means and standard deviations for all variables are displayed in Table Type of diabetes Compared to people with type diabetes, people with type diabetes had a ... the statistical analysis and drafted the manuscript AV designed the computerized PRISM-R measure and contributed to the manuscript MdeW contributed to the quality of data management and the manuscript...
- 7
- 395
- 0
Báo cáo hóa học: " Research Article AWPP: A New Scheme for Wireless Access Control Proportional to Traffic Priority and Rate" pdf
... It can be seen that regarding MP traffic, performance degradation starts at significantly lower load in POAP than in AWPP HCCA exhibits a steady behavior to a limited load, as it is already explained ... STA A (i) Polling a Station That Has No Packets for Transmission (Figure 1 (a) ) The AP polls a station and the latter responds that it has no packets for transmission (ii) Polling a Station That ... in AWPP of traffic throughput to traffic load and the average delay in AWPP are depicted in Figures and 6, respectively As it can be seen, the analytical and the simulation results coincide to a great...
- 11
- 516
- 0
Báo cáo hóa học: " Research Article Eigenvalue Problem and Unbounded Connected Branch of Positive Solutions to a Class of Singular Elastic Beam Equations" docx
... Differential and Integral Equations, vol 2, no 1, pp 91–110, 1989 Z Bai, “The method of lower and upper solutions for a bending of an elastic beam equation,” Journal of Mathematical Analysis and Applications, ... fourth-order boundary value problems,” Journal of Mathematical Analysis and Applications, vol 116, no 2, pp 415–426, 1986 R P Agarwal, “On fourth order boundary value problems arising in beam analysis,” ... 10871120 and HESTPSP J09LA08 References R P Agarwal and D O’Regan, “Nonlinear superlinear singular and nonsingular second order boundary value problems,” Journal of Differential Equations, vol...
- 21
- 286
- 0
Báo cáo hóa học: " Research Article Stability Analysis and Intermittent Control Synthesis of a Class of Uncertain Nonlinear Systems" doc
... control, and some exponential stability criteria are established Finally, some conclusions and remarks are drawn in Section Problem Formulation and Preliminaries Consider a class of nonlinear uncertain ... ≥ to denote a positive negative, seminegative, and semipositive definite matrix P Journal of Inequalities and Applications Exponential Stabilization of a Class of Uncertain Nonlinear System This ... inverse A t and ΔF t are time-varying uncertainties with DΔFE, in which D and E are real constant matrices of ΔF T t ΔF t ≤ I and satisfy A t 0, appropriate dimensions f : Rn → Rn is a continuous...
- 13
- 444
- 0
Báo cáo hóa học: " Research Article On a New Hilbert-Hardy-Type Integral Operator and Applications" pptx
... Mathematical Analysis and Applications, vol 325, no 1, pp 529–541, 2007 B G Pachpatte, “On some new inequalities similar to Hilbert’s inequality,” Journal of Mathematical Analysis and Applications, ... operator is obtained As applications, a new Hilbert-Hardy-type inequality similar to 1.3 is given, and two equivalent inequalities with a best constant factor as well as some particular examples ... 1998 B G Pachpatte, “Inequalities similar to certain extensions of Hilbert’s inequality,” Journal of Mathematical Analysis and Applications, vol 243, no 2, pp 217–227, 2000 N Das and S Sahoo, “New...
- 10
- 333
- 0
báo cáo hóa học:" Research Article Complete Asymptotic and Bifurcation Analysis for a Difference Equation with Piecewise Constant Control" potx
... nonlinear nature of our model at hand Indeed, we are dealing with a dynamical system with piecewise constant nonlinearlities see e.g., 2–6 , and the usual linear and continuity arguments cannot be applied ... will allow the bifurcation parameter λ to vary from to ∞ Indeed, we will consider five cases: i < λ < c/ − a , ii λ c/ − a , iii c/ − a < λ < b c / − a , iv λ b c / − a , and v λ > b c / − a and ... derive a complete asymptotic and bifurcation analysis for our new equation and show that, among other things, our expectation is not quite true and perhaps such discrepancy is due to the nonlinear...
- 13
- 311
- 0
báo cáo hóa học:" Research Article The Permanence and Extinction of a Discrete Predator-Prey System with Time Delay and Feedback Controls" ppt
... response,” Journal of Mathematical Analysis and Applications, vol 281, no 1, pp 395–401, 2003 T K Kar and U K Pahari, “Modelling and analysis of a prey-predator system with stage-structure and harvesting,” ... response,” Journal of Mathematical Analysis and Applications, vol 317, no 2, pp 464–474, 2006 D T Dimitrov and H V Kojouharov, “Complete mathematical analysis of predator-prey models with linear prey ... and Applications, vol 295, no 1, pp 15–39, 2004 10 X Yang, “Uniform persistence and periodic solutions for a discrete predator-prey system with delays,” Journal of Mathematical Analysis and Applications,...
- 20
- 442
- 0
báo cáo hóa học:" Research Article Exponential Stability and Global Attractors for a Thermoelastic Bresse System" pdf
... Pata, “Global attractors for a semilinear hyperbolic equation in ˜ viscoelasticity,” Journal of Mathematical Analysis and Applications, vol 260, no 1, pp 83–99, 2001 22 V Pata and A Zucchi, “Attractors ... Notes in Mathematics, Chapman & Hall/CRC, Boca Raton, Fla, USA, 1999 26 A Pazy, Semigroups of Linear Operators and Applications to Partial Differential Equations, vol 44 of Applied Mathematical Sciences, ... Systems and Their Attractors, vol 184 of Operator Theory: Advances and Applications, Birkh¨ user, Basel, Switzerland, 2008 a 24 S Zheng and Y Qin, “Maximal attractor for the system of one-dimensional...
- 15
- 344
- 0
báo cáo hóa học:" Research Article Hardy-Littlewood and Caccioppoli-Type Inequalities for A-Harmonic Tensors" pdf
... n, be an A- harmonic tensor in a domain M ⊂ Rn and ρ > Assume that < s < ∞ is a fixed exponent associated with the A- harmonic equation and w ∈ Ar M for some r > Then there exists a constant C, ... “Local and global norm comparison theorems for solutions to the nonhomogeneous Aharmonic equation,” Journal of Mathematical Analysis and Applications, vol 335, no 2, pp 1274–1293, 2007 S Ding and ... u and v are a pair of conjugate harmonic tensors; see Hence, the Hardy-Littlewood w2 and c over any ball inequality is applicable Using inequality 2.5 with w1 B, we can obtain the norm comparison...
- 14
- 209
- 0
báo cáo hóa học:" Research Article Using a State-Space Model and Location Analysis to Infer Time-Delayed Regulatory Networks" potx
... and analysis 6 EURASIP Journal on Bioinformatics and Systems Biology Table 1: Parameters for the artificial data The artificial data involves regulators (R1, R2) and genes (G1–G9) Names Regulator ... gene-expression data The tool has been demonstrated on artificial data and yeast cell-cycle gene-expression data Using the yeast microarray data, we have illustrated that our model can help identify regulatory ... microarray data published by Spellman et al [21] Details of both data sets are described in the following sections 3.1.1 Artificial Data The artificial data consists of data streams of regulators,...
- 14
- 545
- 0
Báo cáo hóa học: " Research Article APRON: A Cellular Processor Array Simulation and Hardware Design Tool" doc
... cellular automata, and other phenomena related to CPAs, with a variety of tools for data analysis, performance evaluation, and algorithm development APRON software is written to take advantage of ... and algorithms All APRONScript code can be checked for syntax errors and validated automatically The scripting language does not require variable declaration and operates on an assumption that ... uses a hardware device and APRON as a software interface or graphical user interface to the hardware 4.2 Modelling ASPA in APRON The ASPA vision chip [5] is a digital cellular processor array,...
- 9
- 355
- 0
Báo cáo hóa học: " Research Article Lutin: A Language for Specifying and Executing Reactive Scenarios" potx
... the actual implementation, for an average value av and a standard variation sv, we use a relatively simple approximation as follows (i) First of all, the underlying discrete repartition law is approximated ... of literals) abce is a solution of the formula It means that variables a and e should be false; variables b and c should be true; and variable d can be either true or false The monomial abce, therefore, ... Process Algebra, NorthHolland, Amsterdam, The Netherlands, 2001 V A Saraswat, Ed., Concurrent Constraint Programming, MIT Press, Cambridge, Mass, USA, 1993 M Nielsen, C Palamidessi, and F D Valencia,...
- 11
- 389
- 0
Báo cáo hóa học: " Research Article Design, Analysis, and Performance of a Noise Modulated Covert Communications System" ppt
... communications system is shown in Figure 1 (a) A random noise generator generates a zero-mean band-limited Gaussian noise waveform This Gaussian noise is passed through a bandpass filter The bandpass ... (t) and nH (t) terms are independent zero-mean band-limited Gaussian noise in the vertical and horizontal polarization channels, and these terms are also independent of V (t) and H(t) Their analytical ... short-range (less than km) and low frequency (less than 20 GHz) applications, we can assume that the amplitude and phase factors are the same for both polarization channels, since they are specifically...
- 12
- 274
- 0
Báo cáo hóa học: " Research Article On a Hilbert-Type Operator with a Symmetric Homogeneous Kernel of −1-Order and Applications" doc
... [3] B Yang, “On the norm of an integral operator and applications,” Journal of Mathematical Analysis and Applications, vol 321, no 1, pp 182–192, 2006 [4] B Yang, “On the norm of a self-adjoint ... operator and a new bilinear integral inequality,” Acta Mathematica Sinica, vol 23, no 7, pp 1311–1316, 2007 ´ e [5] A B´ nyi and C Oh, “Best constants for certain multilinear integral operators,” ... Journal of Inequalities and Applications, vol 2006, Article ID 28582, 12 pages, 2006 [6] B Yang, “On the norm of a certain self-adjiont integral operator and applications to bilinear integral inequalities,”...
- 9
- 334
- 0
Báo cáo hóa học: " Research Article ASAP: A MAC Protocol for Dense and Time-Constrained RFID Systems" pdf
... transmits Collision ACK command is ‘0’ Ack wait Successful: ACK command is ‘1’ Silent - ID Identified Reader command, ACK command Kill command Destroyed Reader command, ACK command Figure 2: ASAP: ... design of ASAP to variants of ASAP, that is, p-ASAP, m-ASAP, and ASAP with faulty tags For each scenario, we have modified the ML estimator appropriately for providing the best performance We have shown ... read performance of a particular arrival model and consider the design of the initial tag count, the tag arrival rate, and the tag departure rate in a mobile RFID system, such that P% tags are...
- 13
- 355
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008