hybognathus amarus during a long term flood pulse in the middle rio grande new mexico
Fisheries science JSFS , tập 77, số 2, 2011 3
... temperate anguillid species such as the European eel A anguilla and the American eel A rostrata in the Atlantic and the Japanese eel A japonica in the Pacific [2], but migrating adults have historically ... panel shows a dorsal image and the lower shows a lateral image; h indicates the swimming angle according to the above parameters The angle was that between the centerline of the fish, an imaginary ... [6] Jack mackerel is caught by trawl as well as purse seine in Japan, and it is one of the important target species of the large trawl in the East China Sea The whitefin jack Kaiwarinus equula is...
- 119
- 482
- 0
Tài liệu Báo cáo khoa học: Identification of differentially expressed genes of the Pacific oyster Crassostrea gigas exposed to prolonged thermal stress docx
... ACCAGAAGACATTACAGTGAAAATTGA GGGAACCAGCAGTCGTCAAA CGTCCACTGAGAGGATGAGACA AAAGCAGAGCAGAAAAAGTGGAA GGACAATGCCGCGATCAG CAATGAACAAAAAAGTCGCAACA GGGATGGAGGGTAAGACCATACA ACGGAGGTTGACGGGACTT GCTGGCACCACGATTGG ... AATGCTGGCTCTCCCTCGAT GCTTGGCTACTGGACCATCAA GGAAATGGAAATAACAAGACAAATAGC GCGCAACTAATGCTTCCACAA TGACCAAGGCAACAGAACCA AATCAGACGGCCGGTATGTG CGAAAAAGGACAGCAGTTGAAA CTCATCCTCCACCGGATTGT CGTCCGATTTCTTCTCGTGTTT ACCAGAAGACATTACAGTGAAAATTGA ... to 3’) MTA-1 AATGCTGGCTCTCCCTCGAT GCTTGGCTACTGGACCATCAA GATACAGCAAACGGAAAGTCAACA CAGTTCCTCGGGCCAACA GCCCCCCTCCCACACA CATCTTCGGCCGTCTTTCC GTTCTTGTTCCTGCTCATCAGTATG TGGATCGCCAAAAACTCATG AATGCTGGCTCTCCCTCGAT...
- 11
- 570
- 0
Báo cáo khoa học: Antimicrobial activity of histones from hemocytes of the Pacific white shrimp ppt
... gradient is indicated by the dashed line The peaks containing the histone proteins are indicated with the arrows histone H 2A (data not shown) Also, a fraction containing a histone H1 fragment inhibited ... HLQLAIR YLAAEVLE AGLQFPVGR AERVGAGAPVY PNIQAVLLPK AIRNDEELNKLL RVGAGAPVYLAAVMoxEb LLSGVTIAQGGVLPNIQAVLLPK AIRNDEELNKLLSGVTIAQGGVLPNIQAVL T G T C T C G T C H 2A H 2A H 2A H 2A H 2A H 2A H 2A H 2A H 2A 3388.22 ... antimicrobial mechanism [25] Three peptides derived from the N-terminus domain of histone H 2A: buforin I (39 amino acids), parasin I (21 amino acids), and hipposin (51 amino acids) from the Asian toad...
- 9
- 373
- 0
Báo cáo khoa học: Response of the Pacific oyster Crassostrea gigas to hypoxia exposure under experimental conditions pot
... 5¢-GATGACGTCCCCAGTCATGAGGGGTGGTC-3¢ 5¢-TGGGGGATGGAGGGTAAGACCATACACTT-3¢ 5¢-TTCTATAACGGAACATTATACCAACAAGG-3¢ 5¢-CAACATTTACCTGGGGCAGGTGGGTTCAG-3¢ 5¢-AATCCAAAAGTGCAGGCCTCACTAGCAGC-3¢ 5¢-TTGCCGACTAATTCCGGGACTCCATCATC-3¢ ... 5¢-TTGCCGACTAATTCCGGGACTCCATCATC-3¢ 5¢-CCGTCTTGCCAGAGTTTCTCCACCTCCTC-3¢ 5¢-GTCGTCAACAACGATCCTGACGTTGGGGA-3¢ 5¢-TACTGTCTTCTGCTAAACGCCAC-3¢ 5¢-GTCGTGATATTGAGGTGCCAGCC-3¢ 5¢-GCCCAGACGGGAAAATGCGTGTG-3¢ 5¢-CAGTTACACGATGCTTTGGCGCA-3¢ ... used in RT-PCR expression analysis Genes Primer sequences Carbonic anhydrase Glutathione peroxidase Myc homologue 5¢-AAACAGGCGGGAAACCACAGTAACACGGT-3¢ 5¢-CACTGGACGCTTTCATAACAAGGGGGCGT-3¢ 5¢-GATGACGTCCCCAGTCATGAGGGGTGGTC-3¢...
- 18
- 286
- 0
Company Taxation in the Asia-Pacific Region, India, and Russia docx
... of the Asia-Pacific region, namely Australia, Cambodia, China, Hong Kong, Indonesia, Japan, Malaysia, Philippines, Singapore, South Korea, Taiwan, Thailand, and Vietnam, plus India and Russia The ... territories in the Asia-Pacific Region and India Company Taxation Regimes in the Asia-Pacific Region, India, and Russia (Chap 2) A comparison of the company tax regimes in the Asia-Pacific region, India, and ... 12.5% in Indonesia and 45.1% in South Korea Machinery is depreciated according to the straight-line method in China, Malaysia, Russia, Singapore, Taiwan, and Vietnam at an allowance rate ranging...
- 100
- 354
- 0
Báo cáo khoa học: Molecular identification and expression study of differentially regulated genes in the Pacific oyster Crassostrea gigas in response to pesticide exposure doc
... 5¢-GGCCCGACGGGTGTCTCTCCAGACCCGT-3¢ 5¢-TAACCTCCAAAAACTTGCACGTCGGCAA-3¢ 5¢-GCACAGTTCCCCTACAGTCCCGCTTTAG-3¢ 5¢-CACGTCTCAGCAGGGAGAATAATCCCGA-3¢ 5¢-GAGCTCAGCGAGGACGGAAACCTCGCGT-3¢ ADI (up) 5¢-CCAATCAGGTAGGCCTTCATGGAGAGGA-3¢ ... 5¢-CTTTCTGGCCTCTCCAACATCCATGCCA-3¢ 5¢-ATGCCAAGGTAGTTTATGATGATCGAGA-3¢ 5¢-TCTCCTACGATCATCTCACCGTCACCGA-3¢ ADI (down) G (down) ADI (down) 5¢-GGTTGTCAATTTATTGAATGATCTCTACA-3 5¢-CATTTTGACTCGTCCCGATAAACAGGCA-3¢ ... 5¢-CCAATCAGGTAGGCCTTCATGGAGAGGA-3¢ 5¢-CCCAGAGATCCTCCAAGAGACAGCCAGT-3¢ ADI (up) ADI (down) ADI (down) 5¢-ATCTGGAGAGCACATCATTGCTGGTGCA-3¢ 5¢-ACATCGAGGAAGAGTTTTCTATCCTGGA-3¢ 5¢-ACATCGCTGAGAATGTCAACGGGGATAT-3¢ 5¢-CTTTCTGGCCTCTCCAACATCCATGCCA-3¢...
- 14
- 413
- 0
Báo cáo lâm nghiệp: "Solar activity, global surface air temperature anomaly and pacific decadal oscillation recorded in urban tree rings" pot
... Treering Measurement and Analysis System Data was assessed using TASP-Win software The resulting data set for trees at each individual site was tested for dating accuracy using the program COFECHA [30] ... million; Area: 515 km2 ) is an important industrial city, the capital of Liaoning Province and China’s fifth largest city The city lies in the alluvial plains of the Liaohe and Hunhe rivers Its mean annual ... observed in the band 2–20 year periodicities (Tab IIIA) Alternate signals in this band are also present in some periods but absent in others, and the signal was clearly non-stationary In some periods...
- 14
- 348
- 0
1500 Test C.pdf
... I read an interesting in the paper the other day a article b information c news d reporting > a 48 We were made all the cleaning in the house a to b c doing d done a 49 I’ve only had time ... cold a in fact b in time c in order d in case > d 46 They are going to sack a number of administrative staff as a result of a massive reorganization program a lay up b lay out c lay off d lay ... cigarettes, too a box b packet c jar d case b 13 I was this morning a Because of the rain, / an hour late b Because of the rain, / late an hour c Raining / late for an hour d Because of raining,...
- 428
- 2,481
- 11
Bảo quản thực phẩm
... hoảt h a hc cao cọ thãø phạ hy cáúu tảo ca hảt, lm gim giạ trë dinh dỉåíng hồûc giạ trë thỉång pháøm väún cọ ca hảt Vê dủ : mãtylabrämua cọ thãø kãút håüp våïi h a chỉïc -SH v -SCH3 ca protein cọ ... nọng, dảng âáưu tiãn ca náúm mäúc thỉåìng phạt triãøn khäúi hảt l Altenaria, Cladosporium sau âọ âỉåüc thay thãú bàòng Aspergillus v Penicillium Trong cạc loi náúm mäúc thç Asp.Flavus phạt triãøn ... thåìi gian bo qun 38 4.1.3 Sỉû thay âäøi âäü axit v chè säú axit cháút bẹo ca bäüt bo qun : Âäü axit ca bäüt l säú ml NaOH 1N cáưn thiãút âãø trung hãút cạc axit cọ 100g bäüt Chè säú axit cháút...
- 104
- 870
- 2
Cấu tạo giải phẫu thực vật
... (Cucurbitaceae), họ Boraginaceae CaCO3 tạo bào thạch thường gặp họ Da (Moraceae), họ Urticaceae, họ Acanthaceae, họ Begoniaceae Tế bào ch a bào thạch thạch bào 37 NHỮNG GIAO THÔNG GI A CÁC TẾ ... lông ng a, d a SiO2 tẩm mặt 5.5.2 Oxalat calcium Oxalat calcium có làm thành kết tinh nhỏ tế bào vỏ trái họ D a (Palmae) Cương bào sen, súng ch a nhiều kết tinh oxalat 5.5.3 Vôi CaCO3 Vôi CaCO3 ... hay dịch chất nước chất h a tan khác đường (glucid, maltoz, inulin …) sắc tố antocian (đỏ, tím, xanh, vàng ), lipid gặp không tan nước, protid holoproteid, acid hữu (acid citric, acid malic CAM,...
- 199
- 3,148
- 12
Phụ gia thực phẩm
... Axit alginic Alginic Acid Nhũ h a, chất độn, ổn đònh 402 Kali alginat Potassium Nhũ h a, ổn đònh Alginate 403 Amoni alginat Ammonium Nhũ h a, ổn đònh Alginate 404 Canxi alginat Calcium Alginate ... Nonalactone, gamma- gamma- 332 Nonanal Nonanal 333 Octanal Octanal 334 Piperonal Piperonal 335 Quinin hydroclorua Quinine 327 328 329 hydrochloride 336 Undecalacton, gamma- gamma- Vanillin 337 Undecalactone, ... KHOA CÔNG NGHỆ THỰC PHẨM 341 A E calcium phosphates 50 mineral salt, anti-caking agent, firming agent 342 A ammonium phosphates mineral salt 343 A magnesium phosphates mineral salt, anti-caking...
- 165
- 1,747
- 12
Giáo trình thuốc bảo vệ thực vật
... Leptinotarsa decemeatas h i khoai tây; 1892 gipxin (asenat chì) ñ tr sâu ăn qu , sâu r ng Porthetria dispr N a cu i th k 19 cacbon disulfua (CS2) ñư c dùng ñ ch ng chu t ñ ng r p Pluylloxera h i nho ... sáp Aspidiotus perniciosus h i cam (1881) M ñ u cho vi c dùng ch t xông BVTV s ki n dùng HCN tr r p v y Aonidiella aurantii h i cam (1887) Năm 1889, aseto asenat ñ ng ñư c dùng tr sâu Leptinotarsa ... ñ c ñ n th sinh v t, hay so sánh ñ ñ c c a lo i thu c v i nhau, ngư i ta chia ra: Li u dư i li u gây ch t: li u lư ng ch t ñ c ñã phá hu nh ng ch c c a th sinh v t, ch a làm ch t sinh v t B ng...
- 13
- 3,471
- 37
Công nghệ chế biến thực phẩm đóng hộp
... isosaccharosan kết với nhau, loại phân tử nước tạo thành caramelan Caramelan lại kết hợp với isosaccharosan, loại phân tử nước tạo thành caramelen Khi nhiệt độ tăng cao 200oC tạo thành caramelin ... thành pheophytin, caroten bị phân hủy, lại tan nhiều dầu nóng làm cho dầu có màu da cam Các chất hữu h a tan vitamin h a tan chất béo chuyển vào dầu Vitamin B1, B2 tổn thất Vitamin C bị phá hủy ... CHẤT CHỐNG OXY H A E 300 Liều lượng chấp nhận (mg/kg thể trọng/ngày) Acid L-ascorbic E 301 Không giới hạn L-ascorbat Na L-ascorbat Ca Acid diacetyl 5,6-L-ascorbic Acid palmityl 6-L-ascorbic E 302...
- 127
- 1,356
- 7
Phương pháp kiểm nghiệm vi sinh vật trong thực phẩm
... Putrescine Hoạt động toàn hệ thống sau Arginine dehydrolase L-Arginine L-Agmatine + CO2 Agmatinase (agmatine ureohydrolase) Putrescine + Urea Urease NH3 + CO2 Agmatinase (agmatine ureohydrolase) ... ứng arginine decarboxylase: trình trao đổi arginine nhờ enzym arginine dehydrolase tiến hành theo sơ đồ sau: NH CNH2 CH2 Decarboxylase NH (CH2)2 (CH2)2 CH NH2 CH2 + CO2 NH2 NH2 COOH L-Arginine ... tham gia vào loạt phản ứng khác, cuối thu sản phẩm CO2 NH3 + Phản ứng arginine dehydrolase: trình trao đổi chất theo hướng khử hydro arginine diển theo sơ đồ sau: Arginase L-Arginine Ornithine...
- 56
- 1,802
- 12
Chất lượng và vệ sinh an toàn thực phẩm
... tố nấm mốc đề cập đến nhiều aflatoxin, ochratoxin, patulin, trichothecenes, fumonisin, zearalenone Độc tố Nguồn Thực phẩm liên quan Aflatoxin Aspergillus flavus A parasiticus Các loại hạt có dầu, ... (lạc), s a Trichothecenes Chủ yếu Fusarium Các loại ngũ cốc Ochratoxin A Penicillium verrucosum A ochraceus L a mỳ, l a mạch Fumonisins Fusarium moniliorme Ngô Patulin Zearalenone P expansum Fusarium ... mycotoxin - Có khả phân hủy sinh học loại thải (theo phân vật nuôi) Aflatoxin công gan Ocharatoxin A công thận Trichothecenes công chất nhờn Egot alkaloids hệ mạch ngoại vi Zearalenone công ống sinh...
- 74
- 1,579
- 9
Thực hành công nghệ lên men
... phần hoa bia mà ta quan tâm chất đắng gồm acid đắng nh a đắng; tannin; tinh dầu Trong công nghệ sản xuất bia người ta sử dụng trực tiếp hoa bia chế phNm từ hoa bia bột hoa hay cao hoa bia c) Nấm ... chia sợi thành nhiều tế bào Asp oryzae có khuNn lạc, màu sắc bào tử hình thái giống Asp flavus, loài nấm tổng hợp aflatoxin KhuNn lạc Asp.flavus Asp oryzae 24 Asp oryzae Asp flavus Aflatoxin ... x 2.0-9.0 mm 34 Lactobacillus acidophilus (© Miloslav Kalab, Agriculture et Agroalimentaire Canada, Ottawa) 3) Sản ph m trao đổi chất vi khu n lactic trình lên men i) Acid lactic (CH3-CHOH-COOH,...
- 40
- 1,368
- 8
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25