hrm analysis of the ssii mutants
báo cáo khoa học: " QTLs and candidate genes for desiccation and abscisic acid content in maize kernels" docx
... recent report [37] The comparison of the transcript expression profiles of five of the six identified maize NCED genes shed new light on the relative autonomy of the embryo and the endosperm compartments ... the risks associated with these threshold values, classical permutations were performed to determine the probability of the maximum of the test statistics under the null hypothesis (absence of ... using the tools set up by ‘Génoplante’ http://urgi.versailles.inra.fr/, which yields the list and genetic coordinates of the genes or ESTs reported in the vicinity of the QTLs Because of the use of...
- 22
- 201
- 0
Báo cáo khoa học: Genomic structure and expression analysis of the RNase j family ortholog gene in the insect Ceratitis capitata pptx
... (NW_001834409:c1450413–1449631) The numbers above the boxes indicate the size of the exons, and those below the lines indicate the size of the introns (B) Multiple amino acid sequence alignment of the RNase j family ... bp upstream of the poly(A) tail of the shorter transcript and the second one is located 46 bp upstream of the poly(A) tail of the alternative transcript The hexanucleotide AAUAAA is the predominant ... were also found in the 3¢ UTR, one of them just 46 bp upstream of the poly(A) tail The remaining two poly(A) signals are upstream of the region that contains the AUUUA motifs and the poly(U) tracts,...
- 11
- 479
- 0
Báo cáo khoa học: Expression studies of the core+1 protein of the hepatitis C virus 1a in mammalian cells pot
... levels in the presence of core was the result of an overloading of the cellular protein-synthesis machinery and of a shortage of its components Finally, we examined the possible effect of core+1 ... predicts the instability of a protein on the basis of the presence of certain dipeptides the occurrence of which is significantly different in the unstable proteins compared with those in the stable ... effect of the core protein on the translation and ⁄ or the stability of the core+1 protein However, no effect of the core+1 protein on core expression could be detected Expression of the core+1...
- 18
- 365
- 0
Expression studies of the proteolytic p10 fragment of the neuronal cdk5 activator in mammalian cells
... dementia and later extended to the dementia among the elderly The second important step of the concept of AD was the clear characterization of the disease state The term dementia, which predates ... and cure the disease 1.8 Objectives of the present study Cdk5/p35nck5a is one of the candidates responsible for the hyperphosphorylation of tau protein which is the main component of the AD hallmark, ... patients thought that their spouses were their mothers or their children their siblings, or they even failed to recognize their family members Some patients claimed that the house they were living...
- 121
- 319
- 0
Expression studies of the proteolytic p10 fragment of the neuronal cdk5 activator in mammalian cells
... dementia and later extended to the dementia among the elderly The second important step of the concept of AD was the clear characterization of the disease state The term dementia, which predates ... and cure the disease 1.8 Objectives of the present study Cdk5/p35nck5a is one of the candidates responsible for the hyperphosphorylation of tau protein which is the main component of the AD hallmark, ... patients thought that their spouses were their mothers or their children their siblings, or they even failed to recognize their family members Some patients claimed that the house they were living...
- 121
- 218
- 0
báo cáo khoa học: "Structure and expression of the maize (Zea mays L.) SUN-domain protein gene family: evidence for the existence of two divergent classes of SUN proteins in plants" pot
... exons, and the SUN domain was split between the exons On the other hand, the PM3 genes had 4-5 exons and a SUN domain that was encoded within the largest exon Comparative analysis of the maize ... larger than the predicted protein sizes Given the number of cysteine residues and the possibility of disulfide bridges, we examined the effect of prolonged boiling times in the presence of reducing ... also suggest that the PM3 proteins originated early in the life of the plant kingdom, predating the origin of flowering plants The second, four orthologous groups observed within the grass species...
- 22
- 451
- 0
báo cáo khoa học: " Selection of reference genes for quantitative real-time PCR expression studies in the apomictic and sexual grass Brachiaria brizantha" ppt
... geometric mean of the expression values of the set of the control genes tested The lower the M value, the more stably expressed the gene is Also, the program enables the exclusion of the most unstable ... region of the gene The M value for both sets of primers was the same, showing that the amplification region had no influence on the expression stability Although the difference in the M value of the ... M value of all the other genes and also a change in the M values of the unstable genes, BbrizGDP and BbrizUBI (Figure 3b) To check if the Figure Box-whisker showing the Ct variation of each candidate...
- 10
- 267
- 0
Báo cáo y học: "Characterization of N200 and P300: Selected Studies of the Event-Related Potential Salil H. Patel 1 and Pierre N. Azzam 2"
... interspersed by a stimulus which deviated from the standard in the intensity of the first component and the glide direction of the second constituent The number of distinct MMN components elicited by ... 56]; these findings further support the concept of the P3 as a proxy for some element of stimulus evaluation time Evidence has accumulated describing the P300 as a cognitive routine supporting the ... and the N2b Data indicate that the P300 is involved not only in processes of working memory, but may interact with the N2b in the control of motor response to external cues Through the use of...
- 8
- 563
- 0
Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx
... interacts with both O6 and N7 (Fig 1C) The 2¢OH of the ribose is hydrogen bonded to the main chain and the side chain of Asp142 (Fig 1C) Both hydroxyl groups of the ribose are involved in coordinating ... product of PRPP from the crystallization solution ing 81 compounds of substrates, products and regulators of other enzymes in the human nucleotide metabolism (Table S1) The library can then be ... conclusion can be made based on the lack of thermal shifts when only the bases were added, whereas the addition of PRPP led to a significant thermal shift Kinetic studies of PRTFDC1 showed that this...
- 11
- 770
- 0
Tài liệu Báo cáo khoa học: Mechanism of dihydroneopterin aldolase NMR, equilibrium and transient kinetic studies of the Staphylococcus aureus and Escherichia coli enzymes docx
... set of control data was obtained in the absence of the protein The data set obtained in the absence of the protein was then subtracted from the corresponding data set obtained in the presence of ... performed in the absence of the ligand The control data set obtained in the absence of the ligand was subtracted from the corresponding data set obtained in the presence of the ligand The Kd values ... 70 after the addition of the enzyme The top spectrum is that of DHMP for comparison Only the NMR signals of the 2¢ and 3¢ protons of DHNP and DHMP are shown The chemical structures of DHNP and...
- 13
- 479
- 0
Tài liệu Báo cáo Y học: Molecular modeling of the dimeric structure of human lipoprotein lipase and functional studies of the carboxyl-terminal domain docx
... illustrates the overall saddle shape of the dimeric structure and the key heparin-binding residues in the N-terminal domain held coordinately by the two subunits on the top of the hollow (Fig 1A) The ... substrate binding The fact that the substitution mutants in this cluster (the WW and WWW mutants) retain esterase activity but not the lipase activity and that the normal affinity of these mutants for ... established Of two possible dimeric structures of LPL, the head-tohead and the head-to-tail models, the studies of the chimeric proteins of hepatic lipase and LPL and the tandem repeat approach of LPL...
- 10
- 679
- 0
Tài liệu Euphorion Being Studies of the Antique and the Mediaeval in the Renaissance - Vol. II pot
... sunshine of the evening, the noise of the streets, the looks of the crowd, the great minster rising half-finished in the midst of the town by the Rhine, the cries and noise and chipping of the masons; ... attending to the business of factory or counting-house under the orders of the father of the family, and to the economy of the house-under the superintendence of the mother; a manner of living at ... him the "Morte d'Arthur" of the ladies and knights of Arthur's court; of the quest of the Grail by spotless knights who were bastards and fathers of bastards; of the intrigues of Tristram of Lyoness...
- 71
- 630
- 0
Báo cáo khoa học: Fluorescence studies of the replication initiator protein RepA in complex with operator and iteron sequences and free in solution pdf
... set of tting parameters The adequacy of the analyses was determined from the reduced weighted sum of squares of residuals, and visual inspection of the distribution of weighted residuals The ... interpretation of the origin of the static quenching However, judging from the binding stoichiometry together with the shape of the binding curves (Fig 3), it is safe to conclude that the quenching ... Nevertheless, the R(2/3) value in the complex with 1DR is in excellent agreement with the distance measured between the Cb atoms of both residues in the structural model of RepA [2] based on the...
- 15
- 431
- 0
Báo cáo khoa học: Cloning and expression of the first nonmammalian interleukin-11 gene in rainbow trout Oncorhynchus mykiss pdf
... the 5¢-UTR, and four potential poly(A) signals were found in the 3¢-UTR (Fig 1), two of them just 14 or 23 bp upstream of the poly(A) tail The remaining two poly(A) signals were upstream of the ... differences were a 26 bp insertion in the 5¢-UTR of the cDNA and an insertion of 12 repeats with a consensus of CCAATGATGATCCAAGAAATCCACACTACAG (31 bp) in the 3¢-UTR of the cDNA sequence (Fig 1) A TATA ... the trout IL-11 with IL-11 molecules from T Wang et al other species and separate from other members of the IL-6 family In vivo expression of IL-11 RT–PCR was used to examine the expression of...
- 12
- 511
- 0
Báo cáo khoa học: Differential expression pattern of the novel serine⁄threonine kinase, STK33, in mice and men doc
... rather reflects synchrony to other events of the spermatogenesis For instance, the mechanisms unleashing the pass of the haploid germ cells through the tight junctions from the adluminal to the ... resembles that of members of the CAMK family of protein kinases As a step towards understanding their function, we have analysed the distribution of STK33 ⁄ Stk33 RNA and protein as well as the subcellular ... restricted to the cells of the spermatid differentiation process, from the spermatogonia to the early spermatides with a remarkable maximum of signal in the spermatocytes (Fig 2A,B) In all cases the signal...
- 15
- 389
- 0
Báo cáo khoa học: Isolation, characterization and expression analysis of a hypoxia-responsive glucose transporter gene from the grass carp, Ctenopharyngodon idellus potx
... from the poly(A) of GT-cDNA1 and another is located 11 bp upstream from the poly(A) of GT-cDNA2 (data not shown) Of particular interest is the presence of eight AUUUA motifs in the 3¢-UTR of GT-cDNA2 ... size were detected in the total RNA of grass carp kidney; the larger transcript showed a 30-fold higher expression level than the former (data not shown) Further analysis of the ORF showed that ... deduced amino acid sequence of gcGLUT Analysis of the deduced amino acid sequence of GTcDNA1 with the HMMTOP program (http://www.enzim.hu/ hmmtop/) [17] indicated the presence of 12 putative transmembrane...
- 8
- 465
- 0
Báo cáo khoa học: Antimicrobial and conformational studies of the active and inactive analogues of the protegrin-1 peptide docx
... at the two spatial tips of the molecule, at the N-terminus with Arg1 and in the turn in the presence of Arg7 and Arg9 (see Figs and 4) The shorter analogue, BM-2, was the most flexible of all the ... on the membrane This may also account for differences in the haemolytic activity of the peptides A better understanding of the mode of action of these peptides is crucial for the development of ... known as cathelicidins [11], which are synthesized as the C-terminal portion of a cathelincontaining proregion The N-terminal cathelin domain of the precursor is highly conserved at both the amino...
- 13
- 427
- 0
Báo cáo khoa học: Structural studies of the capsular polysaccharide and lipopolysaccharide O-antigen of Aeromonas salmonicida strain 80204-1 produced under in vitro and in vivo growth conditions docx
... comparison of its MS with that of the reference compound The absolute configuration of glycoses was established by capillary GLC of their acetylated (-)-2-butyl glycosides, according to the method of ... with the proposed structure of CPS The linkage of GalNAcA could not be verified as the methylation analysis was carried out without the carboxyl group reduction step To confirm the sequence of this ... stainless steel needle (27 g) was butted against the low dead volume tee and enabled the delivery of the sheath solution to the end of the capillary column The separations were obtained on 90-cm long...
- 10
- 332
- 0
Báo cáo Y học: Engineering and mechanistic studies of the Arabidopsis FAE1 b-ketoacyl-CoA synthase, FAE1 KCS pot
... substitution of basic histidine for the asparagine resulted in inactive enzyme Taken together, the analysis of the decarboxylation activity and characterization of the mutants of the putative ... provided an opportunity to analyze the effect of mutagenesis of His391 and Asn424 in FAE1 KCS To our knowledge, this is the first report of the analysis of the mechanism of a membrane-bound condensing ... purification of N-terminus His-tagged FAE1 KCS Fig Hydropathy analysis of FAE1 KCS (A) Hydropathy plot of FAE1 KCS indicating the presence of several hydrophobic regions The position of the active-site...
- 9
- 457
- 0
Báo cáo khoa học: Characterization and expression analysis of the aspartic protease gene family of Cynara cardunculus L. docx
... the respective cDNAs (Fig 2) revealed the presence of an intron in the 5¢-UTR of the genes The nucleotide sequences of the cDNA and genomic clones of cardosins diverge after a perfect match of ... of cyprosin B isolated was incomplete and encompassed the last six exons of the gene Fig Determination of the transcription initiation site of the cardosin A, B and D genes The alignment of the ... regions of the genes fused to the reporter Each row of panels represents independent flowers of plant lines transformed with the same construct, at different stages of development The names of the...
- 17
- 359
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008