housman michael f barad cetin c kiris and dochan kwak
hoppensteadt f.c. analysis and simulations of chaotic systems
... resonance case occurs when the forcing function has a frequency that matches one of the free frequencies of the problem, that is, one of the eigenvalues of A Subresonant forcing occurs when one of ... namely, the components of ω Such a function is called a quasiperiodic function Quasiperiodic functions are closely related to periodic functions For example, if f is a quasiperiodic function, then ... problems of bifurcation and stability theory, statistical physics, random processes, and celestial mechanics Fourier’s and Poincar´’s work on mathematical physics and dye namical systems continues...
- 331
- 377
- 0
Activation of c h and c f bonds by cyclopentadienyl iridium complexes
... Cp*Ir(CO) (C 6F5 )Cl OC F Ir F Cl F F F 18a Cp*Ir(CO)(COOH)(p -C 6F4 CN) 18b Cp*Ir(CO)(COOMe)(p -C 6F4 CN) 1 8c Cp*Ir(CO)(COOiPr)(p -C 6F4 CN) 18d Cp*Ir(CO)(COOC5H9)(p -C 6F4 CN) OC F Ir F O F OR CN R=H = Me = iPr = Cyclopentyl ... NO2 F 28 Cp*Ir(CO)(H)[2,4 -C 6F3 (CN)2] OC NC Ir F H F CN F 29 Cp*Ir(CO)(COOMe)[2,4 -C 6F3 (CN)2] OC Ir NC F O F OCH3 30 CN F [Cp*Ir(CO)(PPh3)(p -C 6F4 CN)] [F] F F Ir Ph3P OC F- CN F F 31 Cp*(CO)2Ir→BF3 ... Ir O F OR R = Me = nPr F F 24a 24b CF3 25 Cp*Ir(CO)(H)(p -C 6F4 CF3) OC F Ir F H F CF3 F 26 Cp*Ir(CO)(COOH)(p -C 6F4 CHO) OC F Ir F O OH F C F O H xii 27 Cp*Ir(CO)(COOH)(p -C 6F4 NO2) OC F Ir F O F OH...
- 196
- 386
- 0
c interfaces and implementations techniques for creating reusable software
... lcc 3.5 gcc 2.7.2 Alpha OSF/1 3.2A lcc 4.0 gcc 2.6.3 cc MIPS R3000 IRIX 5.3 lcc 3.5 gcc 2.6.3 cc MIPS R3000 Ultrix 4.3 lcc 3.5 gcc 2.5.7 Pentium Windows 95 Windows NT 3.51 Microsoft Visual C/ C++ ... reaches the end of file ¢functions 5²+≡ int getword(FILE *fp, char *buf, int size) { int c; c = getc(fp); ¢scan forward to a nonspace character or EOF 6² C Interfaces and Implementations: Techniques ... interfaces and program specification C Interfaces and Implementations: Techniques for Creating Reusable Software C Interfaces and Implementations: Techniques for Creating Reusabl Prepared for frliu@microsoft.com,...
- 533
- 645
- 3
Pro c# 2010 and the NET 4 platform, troelsen, 5ed, apress, 2010
... your C# compiler to check all of your code for CLS compliance The Role of the Base Class Libraries In addition to the CLR and CTS/CLS specifications, the NET platform provides a base class library ... arithmetic, and ugly syntactical constructs) Despite its complexity, many C+ + frameworks exist today For example, the Microsoft Foundation Classes (MFC) provides the developer with a set of C+ + classes ... architecture that says, in effect, “If you build your types in accordance with the rules of COM, you end up with a block of reusable binary code.” These binary blobs of COM code are often called...
- 1,753
- 682
- 1
C:Documents and SettingsCHI THOIMy Documentsbao cao danh gia thuc hien chuan KTKN cac mon hoc vadoi moi PPDH.doc
... d c vào đầu năm thời điểm năm h c th c thường xuyên, góp phần nâng cao chất lượng giáo d c Vi c th c cam kết đem lại hiệu thiết th c Công t c th c bàn giao chất lượng lớp cho lớp : khảo sát chất ... h c, kì thi h c kì, nhà trường th c cho GV khối kết hợp coi thi với lớp C ng t c th c thường xuyên góp phần giảm thiểu tiêu c c thi c II-Vi c th c đổi phương pháp dạy h c tiểu h c từ năm h c ... tích c c h c sinh, chủ động điều chỉnh dạy h c sát với th c tiễn lớp dạy Kĩ sử dụng đồ dùng dạy h c nhuần nhuyễn, hiệu ( chưa sử dụng máy chiếu: chưa c thiết bị) Về h c sinh : chất lượng học...
- 3
- 422
- 0
Bài soạn C:Documents and SettingAdminMyDocu ments/inh tinh - hoaKhoa học lớp 5 - Hoa.ppt
... nư c chảy I/ Sử dụng lượng gió -Vì c gió? -Không khí chuyển động từ nơi c nhiệt độ cao đến nơi c nhiệt độ thấp sinh gió - Nêu ví dụ t c dụng lượng gió tự nhiên Làm cho chuyển động, c trụ c ... lượng nư c chảy: -Con người sử dụng lượng nư c chảy vi c gì? - Dùng s c nư c để tạo dòng điện ph c vụ sinh hoạt vùng núi - Xây dựng nhà máy thủy điện - Làm quay bánh xe nư c (c n nư c) Thứ ngày ... h c: Kiểm tra c : 1/ Khí đốt tự nhiên khai th c từ đâu? -Sử dụng khí sinh h c 2/ Vì chất đốt cháy c lợi gì? thể ảnh hưởng-Khí đốt tự nhiên khai th c từ mỏ đến môi trường? sử dụng cháy sinh C c...
- 20
- 287
- 0
Tài liệu Michael Hutchison & Kathleen Mcdill - Determinants, Costs, And Duration Of Bank Sector DistressPdf doc
... Analytical issues and empirical literature Much of the theory on banking crises focuses on the special characteristics of banks, such as maturity and currency transformation and asymmetric information, ... sample of countries, highlighting the special circumstances of the Japanese case We review some of the basic statistical characteristics of countries experiencing banking sector distress and test ... special features of banks, combined with particular institutional characteristics of economies, frequently lead to the emergence of banking problems when adverse macroeconomic shocks such as a fall...
- 29
- 469
- 0
professional c# 4 and NET 4 (wrox)
... OC19 OC19 OC20 oC20 OC21 OC21 oC22 oC24 oC26 oC27 LIII S O O O O O O O oC27 oC28 oC29 oC31 OC35 OC36 OC37 OC39 OC40 oC43 OC44 oC48 oC49 oC50 OC50 OC52 O oC53 OC53 OC54 OC54 OC56 OC58 ... oC97 OC98 OC98 OC99 oC101 OC101 OC101 OC102 oC103 OC103 OC104 OC104 oC105 oC106 oC107 OC107 OC108 oC108 OC109 OC111 OC111 OC113 OC114 oC116 OC116 OC120 oC121 oC123 oC124 OC124 XlV S OC124 OC128 ... OC153 oC155 oC157 oC158 oC159 OC159 OC160 OC161 OC161 OC163 oC163 OC164 S O O O O OC165 OC166 OC167 OC169 OC169 oC169 oC170 oC171 OC171 OC172 OC172 oC173 OC173 OC174 OC175 O O oC175 oC177...
- 1,852
- 7,963
- 0
Tài liệu Báo cáo khoa học: 3T3-L1 adipocyte apoptosis induced by thiazolidinediones is peroxisome proliferator-activated receptor-c-dependent and mediated by the caspase-3-dependent apoptotic pathway doc
... Casp3 clved, cleaved caspase-3 TTTTTCAGTGCAGAA-3¢; aP2 forward, 5¢-AAAGACA GCTCCTCCTCGAAGGTT-3¢; and aP2 reverse, 5¢-TGA CCAAATCCCCATTTACGC-3¢ Standard curves were generated with 10-fold serial ... (A) Differentiation of cultured rat primary fat pad cells Rat cells from fat pads, cultured cells isolated from rat fat pads; Rat cells after diff., cultured rat fat pad cells after differentiation ... reverse, 5¢-TTGTC CTCCAGCACCTCAGG-3¢; CD36 forward, 5¢-TCCAGC CAATGCCTTTGC-3¢; CD36 reverse, 5¢-TGGAGATTAC FEBS Journal 277 (2010) 687–696 ª 2009 The Authors Journal compilation ª 2009 FEBS 693 Apoptosis...
- 10
- 594
- 0
Tài liệu Báo cáo khoa học: The resident endoplasmic reticulum protein, BAP31, associates with c-actin and myosin B heavy chain Analysis by capillary liquid chromatography microelectrospray tandem MS ppt
... heptafluorobutanoic acid], centrifuged for at 14 000 g, and the supernatant was injected off-line onto a C1 8 precolumn cartridge (0.5 mm · mm, LC Packings Inc., San Francisco CA, USA) at lLÆmin)1 ... of these interactions even though the amounts of cellular crBAP31 and c- actin did not apparently change (Fig 5B) These findings, coupled with the strong enrichment of the c- isoform of actin recovered ... immunocomplex Fig The pre-apoptotic BAP31 complex specifically recruits c- actin (A) Caspase-cleaved BAP31 (p20; amino acids 1–164) does not interact with c- actin H1299 lung carcinoma cells were transiently...
- 8
- 376
- 0
Tài liệu Báo cáo khoa học: Adaptive changes in the expression of nuclear and mitochondrial encoded subunits of cytochrome c oxidase and the catalytic activity during hypoxia pptx
... genes CYC1 and CYC7, which encode iso-1 and iso-2 of yeast cytochrome c, respectively CytOX 5a and CYC1 are coexpressed under aerobic conditions (O2 > 0.5 lM), whereas CytOX 5b and CYC7 are co-expressed ... elicit nonspeci c and toxic effects in animals To ascertain that the effects of these agents, on the catalytic activity and subunit composition of CytOX were related to their hypoxia-speci c effects, ... absence of differential regulation of a speci c nuclear gene coding for the subunits of CytOX, changes in the microenvironment of the cell may induce alterations in the catalytic efficiency of mammalian...
- 9
- 554
- 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx
... ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG ... Synthetic oligonucleotides used in this study Oligonucleotide name Sequence (5¢- to 3¢) OMCA-KO -F OMCA-KO-R OMCB-KO -F OMCB-KO-R OMCA -F OMCA-R OMCB -F OMCB-R OMCA-PBAD -F CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT ... both decaheme cytochromes c may differ mechanistically Fe(III)-nitrilotriacetic acid saturation curves in the absence and in the presence of two different concentrations of V(V) were plotted and...
- 11
- 731
- 0
Perinatal Mortality Edited by Oliver C. Ezechi and Karen Odberg-Petterson potx
... these classification systems include; the Wigglesworth classification, Tulip classification, Whitfield classification, ReCoDe, CoDaC and the modified Whitfield classification systems (Froen et ... low income countries of sub Saharan Africa and South central Asia are inadequate obstetric and neonatal care, and harmful home care practices, such as the discarding of colostrum, the application ... document your names in this book for posterity. Technical assistance provided by InTech Editorial Office during the production of the book is gratefully acknowledged. Oliver C. Ezechi Chief Research Fellow & Consultant Obstetrician and Gynaecologist, ...
- 156
- 415
- 0
C# in Depth: What you need to master C# 2 and 3 pptx
... pictures from this collection xxviii comments from the tech review Technical proofreaders are a vital part of the book-publishing process They read the final manuscript for technical accuracy and ... effect can be achieved in C# 2, then C# This is the pattern we’ll follow for each of the other pieces of code Listing 1.1 The Product type (C# 1) using System.Collections; public class Product ... Limitations of generics in C# and other languages 102 Lack of covariance and contravariance 103 Lack of operator constraints or a “numeric” constraint 106 Lack of generic properties, indexers, and other...
- 424
- 5,840
- 1
Báo cáo khoa học: Vanadium-induced apoptosis of HaCaT cells is mediated by c-fos and involves nuclear accumulation of clusterin pptx
... HindIII, forward, 5¢-CGAA TTCGCGGAAGCTTCATGTCTGTGGACT-3¢; and BamHI, reverse, stop, 3¢-ATCAGATGGATCCTTATCACTCCTCC CGGTGCTTTTTGC-5¢), the C1 20 cDNA encoding for the minimal Ku70-binding domain of nCLU ... available: Fig S1 Effects of c- fos on HaCaT cell proliferation and CLU expression Fig S2 Effects of VOSO4 on IL-6 expression in HaCaT cells Doc S1 Construction of growth curves and isolation of total ... affected the expression of c- fos oncoprotein and the expression and ⁄ or processing of CLU in HaCaT NeoT and HaCaT Bcl-2 cells (Fig 5C) Whereas treatment of HaCaT NeoT cells with VOSO4 induced...
- 16
- 312
- 0
Báo cáo khoa học: Plant oxylipins: Plant responses to 12-oxo-phytodienoic acid are governed by its specific structural and functional properties ppt
... mainly from arachidonic acid, a fourfold unsaturated C2 0 fatty acid, and have pivotal functions in the inflammatory process, in general reactions to infections and in allergic responses [9] By contrast, ... fruitful discussions Furthermore, the authors thank Professor Dr Eckhard Hofmann for critical comments on the manuscript This work was funded by grants from the Deutsche Forschungsgemeinschaft ... interaction between NPR1 and a TGA subclass of basic leucine-zipper transcription factors has been emphasized [83,84] Taking into account that oxylipins effectively induce TGA transcription factor...
- 12
- 416
- 0
Báo cáo khoa học: Separation and characterization of caveolae subclasses in the plasma membrane of primary adipocytes; segregation of specific proteins and functions docx
... uptake and triacylglycerol synthesis We have previously used biochemical analysis, fluorescence confocal microscopy and electron microscopy to identify the HD-caveolae as speci c sites of fatty acid ... the extracellular space and caveolae lacking access from the cell surface Closed caveolae have restricted access through caveolae openings, and the presence of a ‘diaphragm’ over some caveolae ... LD-caveolae; and (e) closed caveolae without cell surface access have been demonstrated in the plasma membrane by electron microscopy [5] We not know the function of this class of closed caveolae,...
- 12
- 460
- 0
Báo cáo khóa học: C-, 15N- and 31P-NMR studies of oxidized and reduced low molecular mass thioredoxin reductase and some mutant proteins docx
... determining 1 3C chemical shifts than is the case for 1H shifts Steric and stereochemical effects, however, can considerably inuence the 1 3C chemical shifts [29] Oxidized enzymes The 1 3C- NMR spectrum and ... Atom Free FMNa Free TARFa TrxR wild-type TrxR E159Y mutant TrxR C1 38S mutant TrxR C1 38S mutant + PMA C( 2) C( 4) C( 4a) C( 5a) C( 6) C( 7) C( 7a) C( 8) C( 8a) C( 9) C( 9a) C( 10a) C( 10a) C( 10b) C( 10 c) C( 10d) ... affected carbon atoms, in comparison with both TARFH2 and FMNH2, are C( 5a), C( 7), C( 9a) and C( 10a), and as already mentioned above, C( 2) (Fig 7B) With respect to the 1 3C chemical shifts of FMNH2,...
- 16
- 378
- 0
Báo cáo khoa học: Bovine tryptases cDNA cloning, tissue specific expression and characterization of the lung isoform ppt
... tgtcccctcagcgctgcttccggcccgaggaggagaccttcccccaccttccctggccccctgcccaatgcc 936 cacccctggctgacccctctctgctgacccctccctgccctgaacccctgccccagccccctccccactagc 1008 tcagggcgctggcaggggctgctgacactcataaaaagcatggagagcag ... CAGGGCGACTCTGGAGGGCCCCTGGTCTGCAAGGTGAATGGCACCTGGCTGCAGGCGGGGGTGGTCAGCTGG 720 GGCGATGGTTGCGCGAAGCCCAACCGGCCCGGCATCTACACCCGCGTCACCTCCTACCTGGACTGGATCCAC 792 CAGTACGTCCCCCAGGGGCCCtgagcctggtccccaggccgccccctgggtcagcggaggagctggccccca 864 ♦ cagtcccctcaacactgcttccggccgaggaggagaccttcccccaccttccccggccccctgtcccagtgc ... CGGTACTGGAGGCACCACTGCGGGGGCTCCCTGATCCACCCCCAGTGGGTGCTGACCGCAGCCCACTGCGTC 216 GGACCGGAAGTCCATGGCCCCTCATACTTCAGGGTGCAGCTGCGGGAGCAGCACCTGTATTACCAGGACCAG 288 CTGCTGCCCATCAGCAGGATCATCCCCCACCCCAACTGCTACAGCGTTAAGAACGGGGCGGACATCGCCCTG...
- 11
- 527
- 0
Báo cáo khoa học: Cellular retinol-binding protein type II (CRBPII) in adult zebrafish (Danio rerio) cDNA sequence, tissue-specific expression and gene linkage analysis pptx
... (http://mgcdh1.nichd.nih.gov:8000/zfrh/beta.cgi) PCR primers (5¢-CCAGCACATCCAGCTTC-3¢) and (5¢-GCCTGTTTGGAGCATTAG-3¢) (see Fig for primer location) were used to amplify a 442-bp product from DNA of clone ... (MBI Fermentas), 1.5 mM MgCl2, 0.4 lM sense primer (5¢-TTCGCCACCCGTAAGATC-3¢), 0.4 lM antisense primer (5¢-AAACTCCTCTCCAATGACG-3¢), 0.2 mM Fig Nucleotide sequence of a cDNA clone coding for a ... zebrafish CRBPII with other CRBPs, CRABPs, and FABPs The amino-acid sequences of zebrafish CRBPII (ZbfshCRBPII; GenBank Accession number AF363957), chicken CRBPII (ChickCRBPII [43]), pig CRBPII (PigCRBPII;...
- 8
- 368
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25