harmonised tripartite guideline s2b a standard battery for genotoxicity testing of pharmaceuticals
HYDROPONICS – A STANDARD METHODOLOGY FOR PLANT BIOLOGICAL RESEARCHES potx
... Parameters Necessary for In Vitro Hydroponic Pea Plantlet Flowering and Fruiting Treatment (mg / l) 0.0 GA3/NAA/BA 0.01 GA3 0.1 GA3 1.0 GA3 0.01 NAA 0.1 NAA 1.0 NAA 0.01 BA 0.1 BA 1.0 BA Leaf ... hydroponically grown foods can be obtained Acknowledgments Names are necessary to report factually on available data; however, the USDA neither guarantees nor warrants the standard of the product, and ... Fisher’s exact test, and other data was tested by standard analysis of variance and Student-Newman-Keuls multiple range test, when appropriate Cultures were incubated at a constant 26 ± oC under a 16-hr...
- 254
- 505
- 1
Tài liệu "Promoting healthy diets and physical activity: a European dimension for the prevention of overweight, obesity and chronic diseases" doc
... comprehensive approach aimed at making the healthy choices available, affordable and attractive involves taking account of mainstreaming nutrition and physical activity into all relevant policies at local, ... a common forum for action the European Platform for Action on Diet, Physical Activity and Health was launched in March 2005 The Platform brings together all relevant players active at European ... diseases” I STATE OF PLAY AT EUROPEAN LEVEL I.1 Unhealthy diets and lack of physical activity are the leading causes of avoidable illness and premature death in Europe, and the rising prevalence of obesity...
- 22
- 703
- 0
Tài liệu Đề tài " A shape theorem for the spread of an infection " pdf
... is a collection of i.i.d mean A Poisson variables plus a finite number of particles which started at time zero at fixed locations (these are the particles added as B-particles at the start) For ... random-walk paths associated to the various particles and (1) (2) assume that the Markov processes {Yt } and {Yt } are constructed by means of the same set of paths A (·, ρ) starting with state ... right-hand side here for k ≥ The basic inequalities remain valid for k = by trivial modifications which we again leave to the reader For the various estimates we have to take all tk large This will automatically...
- 67
- 490
- 0
Tài liệu OUTLINES OF DAIRY BACTERIOLOGY A CONCISE MANUAL FOR THE USE OF STUDENTS IN DAIRYING docx
... characteristic chemical transformations under anaesthetic conditions, as in a saturated ether or chloroform atmosphere Distribution of bacteria As bacteria possess greater powers of resistance ... liquefying at surface; c, a rapid liquefying form; d, a gas-producing form that grows equally well in lower part of tube as at surface (facultative anaerobe); e, an obligate anaerobe, that develops ... cans are not cleaned immediately upon arrival at the farm, so that the conditions are favorable for rapid fermentation Many of the taints that bother factories are directly traceable to such a...
- 201
- 540
- 0
Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx
... externalities for tobacco use have changed dramatically in the past years, and as a result, policy with respect to managing tobacco usage behavior also has changed The relationship of behavior management ... singular choice of edu cation, marketing, or force of law as a paradigm of choice Each paradigm has a role to play in behavior management; behavior management must be considered from the pragmatic ... goals In this situation, an implicit form of negotiation takes place that consists of rejection of offers by the apathetic individuals until the manager creates an exchange that is worthy of attention...
- 14
- 780
- 0
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf
... R, Takahashi K, Takeda K, Furuyama K, Kaneko K, Takahashi S, Tamai M & Shibahara S (2004) Expression of heme oxygenase-1 is repressed by interferon-gamma and induced by hypoxia in human retinal ... Functional analysis of cDNAs for two types of human heme oxygenase and evidence for their separate regulation J Biochem (Tokyo) 113, 214–218 Takeda K, Ishizawa S, Sato M, Yoshida T & Shibahara S ... Piscataway, NJ, USA) Expression of a- tubulin was examined as an internal control using a- tubulin monoclonal antibody (NeoMarkers, Fremont, CA, USA) Assay for HO catalytic activity YN-1, K562, HeLa...
- 12
- 621
- 0
Embedded, Everywhere A Research Agenda for Networked Systems of Embedded Computers pot
... president of the National Academy of Sciences The National Academy of Engineering was established in 1964, under the charter of the National Academy of Sciences, as a parallel organization of outstanding ... United States of America National Academy of Sciences National Academy of Engineering Institute of Medicine National Research Council The National Academy of Sciences is a private, nonprofit, self-perpetuating ... Project Assistant SUZANNE OSSA, Senior Project Assistant DAVID DRAKE, Project Assistant DAVID PADGHAM, Research Assistant BRANDYE WILLIAMS, Office Assistant vi Preface C ontinued advances in information...
- 236
- 323
- 1
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors ... decreased availability of intracellular Cu [83] and up-regulated by increased availability of Cu [84] Collectively, these data present a strong case for the native role of APP ⁄ Ab in regulating ... Furthermore, an increase in extracellular metals can catalyse Ab oligomerization and aggregation, and the amyloid plaques that subsequently form may then exacerbate intracellular metal deficiency...
- 9
- 634
- 0
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc
... (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT ... of microbial adaptation, horizontal gene transfer is essential for the dissemination and assembly of detoxification pathways that can form part of genomic islands and have both pathogenicity and ... The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on the presence of ascorbic acid in lower eukaryotes...
- 11
- 571
- 0
Embedded, Everywhere A Research Agenda for Networked Systems of Embedded Computers doc
... constraints and creating a system that functions properly for the application domain while remaining understandable and manageable by human operators, users, and—in many cases—casual passersby, ... the relatively constrained capabilities of individual elements Adaptive coordination is a fairly new area of investigation, particularly as it applies to EmNets To obtain necessary adaptability ... from solar panels The limited amount of raw power available will have a substantial effect on all aspects of EmNets, from the amount of computation that can be performed on a local physical sensing...
- 235
- 259
- 0
The Help! Kit - A Resource Guide for Secondary Teachers of Migrant English Language Learners
... federal and state legislative initiatives and various national, state, and local organizations, all of which involve the effort to make English the official language of the U.S The initiatives and ... college attendance requires early and regular attention to courses taken and preparation for standardized testing, as well as parental support and input • Personalize programs and services for Hispanic ... $8,000 a year on average), and often live in substandard housing They tend to come from rural areas of their native countries or the U.S and often have a marginal level of education because they had...
- 251
- 484
- 0
Báo cáo khoa học: "PEAS, the first instantiation of a comparative framework for evaluating parsers of French" potx
... the address of its parameters Of course, all of them are not to be filled in All the information thus annotated is then translated into an XML format Annotation of the example of §2 is translated ... syntactic coverage of English grammars In DARPA, editor Proceedings of the Fourth Darpa Speech and Natural Language Workshop, pages 306-311, Pacific Grove, California, February, Morgan Kaufmann ... divergent parses.' Last of all, the XML format into which we translate the parses is an open exchange format It is an important asset for portability and reuse of parsing technolgy E.g for question answering...
- 4
- 323
- 0
Báo cáo "A new formulation for fast calculation of far field force in molecular dynamics simulations " ppt
... force calculation – a significant calculation part of FMM on GRAPE Remaining parts of the paper are organized as follows In section we gives a summary of the FMM and related algorithms as well as ... Computational Physics 87 (1990) 161 [9] T Amisaki, S Toyoda, H Miyagawa, K Kitamura, Development of hardware accelerator for molecular dynamics simulations: a computation board that calculates nonbonded ... expansion P2 M2 M2L M2L conversion evaluation of formula pseudoparticle potential L2L local expansion Anderson’s method Near field force evaluation of physical-particle force Far field force evaluation...
- 8
- 430
- 0
Selling Financial Products - A proven methodology for increasing sales of banking and financial services doc
... of Banks, Financial Institutions and Corporates worldwide Some of our clients: ■ ABSA ■ Alpha Bank ■ Axa Investment Managers ■ Bank BPH SA ■ Bank of America ■ Bank of China ■ Bank of Kuwait and ... Rabobank ■ Rand Merchant Bank (SA) ■ Rating Agency Malaysia ■ Raiffeisen International and RZB ■ Saudi Arabian Monetary Agency ■ Shell ■ Société Générale ■ Standard Chartered Group ■ State Bank ... the Middle East ■ Bank Pekao SA ■ Bank Zachodni WBK SA ■ BBVA Group ■ BNP Paribas ■ Calyon ■ Central Bank of Kuwait ■ Caixa Geral de Depositos ■ China International Capital Corporation ■ Citigroup...
- 8
- 453
- 1
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx
... Primer location Amplified band (bp) P553 P554 P557 P558 GTGATTCTCTGCTAGATGTTG GGCACTCGAACAGTCATATTG ATTAAGGAGCTTCGGGAGATG CTCTTATACCCAATGCTGCTG First pair GCCTTTGAGTCCATCACTAAC CCAGTGTCTTGGCAGGAATC ... (lane 3) Right: human SBCE2 (lane 1), WM35 (lane 2), hamster AbC-1 (lane 3) and mouse S-91 (lane 4) melanomas; placenta (lane 5) The amount of protein loaded on gels was and lg for placenta (lanes ... (lane 2) or black (lane 3) patients; melanoma WM35 (lane 4); normal epidermal keratinocytes (lane 5); HaCaT keratinocytes (lane 6); C1–4 squamous cell carcinoma (lane 7); dermal fibroblasts (lane...
- 11
- 475
- 0
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt
... Cyanobacteria Synechocystis sp PCC6803 Rhodophyceae (red algae) Cyanidioschyzon merolae Nuclear DNA Chloroplast DNA Cyanidium caldarium Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana ... c attached These recombinant proteins were used for preparation of the antibodies against red algal PsbQ¢, PsbV and PsbU, cyanobacterial PsbU and green algal PsbQ The antibodies against spinach ... Structure of the thylakoid and envelope membranes of the cyanelles of Cyanophora paradoxa Plant Physiol 71, 409–419 21 Shibata M, Kashino Y, Satoh K & Koike H (2001) Isolation and characterization of...
- 11
- 501
- 0
Báo cáo " A numerical model for the simulation of wave dynamics in the surf zone and near coastal structures " pot
... observed values of various wave characteristics, it can be remarked that the numerical model can simulate wave transformation in the nearshore region with an acceptable accuracy. ... the coastal structures. Zero gradients of k and ε are assumed at the offshore, lateral boundaries and at surfaces of coastal structures. A scheme similar to that of Hibberd and Peregrine ... Fig. 1. The bed elevations at cell corners (such as points A, B, C and D in Fig. 1) are evaluated as the average value of the bed elevation at four adjacent points. For example, the bed elevation at point C in this figure is evaluated ...
- 11
- 460
- 0
Báo cáo khoa học: "A Bayesian Method for Robust Estimation of Distributional Similarities" pot
... Contextual word similarity and estimation from sparse data Computer, Speech and Language, 9:123–152 Keiji Shinzato, Tomohide Shibata, Daisuke Kawahara, Chikara Hashimoto, and Sadao Kurohashi 2008 ... relations are used as context profiles as in Kazama and Torisawa (2008) and Kazama et al (2009) From a large corpus of Japanese Web documents (Shinzato et al., 2008) (100 million Scientific Library ... using a large amount of Web data in Japanese and show that the proposed measure gives better word similarities than a non-Bayesian Bhattacharyya coefficient or other well-known similarity measures...
- 10
- 472
- 0
Báo cáo khoa học: "A Structured Model for Joint Learning of Argument Roles and Predicate Senses" pot
... Hajiˇ , Massimiliano Ciaramita, Richard Johansc son, Daisuke Kawahara, Maria Ant` nia Mart´, Llu´s o ı ı M` rquez, Adam Meyers, Joakim Nivre, Sebastian a ˇe a Pad´ , Jan Stˇ p´ nek, Pavel Straˇ ... Role-less Argument Bias Problem For learning of the model, we borrow a fundamental idea of Kazama and Torisawa’s perceptron learning algorithm However, we use a more sophisticated online-learning algorithm ... plausible set of assignments of a predicate sense and its argument roles simultaneously We present an exact inference algorithm for the model, and a large-margin learning algorithm that can handle...
- 5
- 354
- 0
a novel method for the synthesis of titania nanotubes using
... However, the annealed titania nanotubes are crystalline (mostly anatase) and show varied activity depending on the material preparation and annealing atmosphere (Fig 12) Titania nanotubes prepared by ... titania nanotubular arrays were annealed in a nitrogen and oxygen atmosphere at 500 ◦ C for h in a CVD furnace at a heating rate of ◦ C/min The UAT samples annealed under these conditions are designated ... predominantly anatase TiO2 [9,22,23] DRUV–vis spectra of the as-anodized and annealed titania nanotubes are shown in Fig 10 It can be seen that the titania nanotubes annealed under N2 atmosphere...
- 8
- 634
- 0
Tìm thêm: khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25