... generate another manipulated images In these created images, hard tissue normal values were altered in at least two standard deviations Facial profile images were digitally manipulated in the anterior-posterior ... upper and lower jaw variations, as well as a bi-maxillary protrusive profile typical of Mexican subjects, and bi-maxillary retruded profile representing the typical straight profile in Caucasian ... with Class I or normal cephalometric values Using Dolphin Imaging and Graphics ® lateral cephalograms of subjects in natural posture were scanned Lateral cephalogram and profile images of each subject...
... remaining colon wall was normal, but the bowel preparation was poor The invagination of diverticulum has an advantage over diverticulectomy in that it minimizes bowel leakage [15] Moreover, invagination ... which makes its wall weak, as compared to the small intestine that is formed of the inner circular and outer longitudinal muscle layers The vasa recta, which supply the mucosa and submucosa of ... Lawson HH Haemoperitoneum associated with a solitary diverticulum of the sigmoid colon S Afr Med J 1961;35:715-6 Matsagas MI, Fatouros M, Koulouras B, Giannoukas AD Incidence, complications, and...
... demonstrated that CKBM is able to inhibit cell proliferation in human gastric cancer cell line, AGS The data from a subcutaneous implantation model of gastric cancer tissue was also agreeable to ... Introduction Pharmaceutical research of traditional Chinese medicines on cancer prevention and treatment has attracted much attention There are a number of herbs that have shown to have the abilities ... purchased from Amersham (Uppsala, Sweden) and it was performed according to the kit manual Analysis of cell cycle progression Cells were seeded in a 25 cm2 flask at a density of x 106 cells/flask...
... from chemical treatment is classified as a hazardous waste, so it should be treated in a proper way This means that the sludge disposal causes a substantial increase in wastewater treatment cost ... and a microfiltration membrane as separation apparatus The aeration tank was made from Plexiglas with a working volume of liters Air was supplied to the aeration tank through diffusers at a flow ... different samples at various SRT The BOD/COD of influent sample has an average of 0.66 This shows that the denimprocessing wastewater can be classified as rather easily biodegradable waste by aerobic...
... of metabolically active bacteria in activated sludge, Microbial Environ., 19, 61- 70 [15] American Public Health Association, American Water Works Association and Water Environmental Federation, ... with a mesh- filtration unit instead of a membrane) was able to maintain biomass at a very high concentration In this process, stable filtration performance was obtained by intermittent filtration ... (2005) Standard method for examination of water and wastewater, 21st ed [16] Japanese Standards Association (1998) Japanese Industrial Standards, JIS K0102 [17] Tarre, S., Beliavski, M., Denekamp,...
... et al., 200 7a) , water was taken from a municipal water filtering plant (Miyoshi, Hiroshima, Japan) prior to being treated for use as tap water The coliform bacteria and total bacterial counts in ... We also determined the total bacterial count using the standard plate counting method One ml of appropriate dilutions of samples was inoculated in standard plate count agar (Nihon Pharmaceutical ... β-glucuronidase and α-glucosidase, were completely inactivated by the SC-CO2 treatment, whereas phosphatase (alkaline and acid) or naphthol-AS-BI-phosphohydrolase was slightly or a little inactivated...
... [a- doh-bee] [may-sa] Here are a few Spanish place names and their American pronunciations: Lajolla, in California El Cajon, in California La Quinta, in California St Augustine, in Florida [la ... with a hand brake for parking, never a footoperated parking brake The American Automobile All rental cars in the US have automatic transmission and air conditioning as standard equipment, and all ... English language—United States—Glossaries, vocabularies, etc English language—Variation—Great Britain—Handbooks, manuals, etc English language—Variation—United States—Handbooks, manuals, etc...
... financial stability related mandates on the x-axis against the clarity of financial stability objectives in the law or in extraBIS: Central bank governance and financial stability Financial stability ... financial stability – S Oosterloo and J de Haan (2006), “Central banks and financial stability: a survey”, Journal of Financial Stability, No BIS: Central bank governance and financial stability ... more by objectives than by an appraisal of what is realistically achievable given the instruments available.10 Harsh ex post accountability creates a threat to future central bank governance arrangements,...
... carcinoma cells Oncogene 20, 2499–2513 Kanda N, Seno H, Konda Y, Marusawa H, Kanai M, Nakajima T, Kawashima T, Nanakin A, Sawabu T, Uenoyama Y et al (2004) STAT3 is constitutively activated and supports ... RHN(CH2)6CATTTCCCGTAATCGAAGATTACGGGAAATG-(CH2)3 NHR (hpST3dODN), which was derived from the seruminducible element of the human c-fos promoter, and RHN(CH2)6- CATTTCCCTTAAATCGAAGATTTAAG GGAAATG-(CH2)3NHR ... of STAT3 activation and dimerization Chem Biol 13, 1235–1242 Laguillier C, Hbibi AT, Baran-Marszak F, Metelev V, Cao A, Cymbalista F, Bogdanov A Jr & Fagard R (2007) Cell death in NF-kappaB-dependent...
... mental, and spiritual needs of the people that would as far as possible avert the danger A social worker was engaged to live as a friend among the people, and a church, school, and library were provided ... investigated in a way that took much time and strength Her outspoken nature and uncompromising mind often made her draw hard and fast lines in no unmistakable way as to conduct that met her approval ... My best love and congratulations to each I am so glad to have another granddaughter." Each one of the grandchildren had a special place in her thought and affections, and was beautiful to her...
... J D Dikeakos et al is autocatalytically cleaved, a central catalytic domain comprising the catalytic triad of amino acids aspartic acid, histidine and serine, and a stabilizing P-domain involved ... signal peptide (sp.) prosegment (pro) , catalytic domain, P domain (P) and autocatalytically cleaved C-terminal domain (C-term) The speckled area represents the region deleted by de Bie et al [8], ... secretagogue forskolin Fc-containing proteins in the culture supernatants were immunoprecipitated with protein A sepharose, separated by SDS ⁄ PAGE, and detected by fluorography (C) Autoradiograms...
... conjugated upper primer was 5¢-GGAATTCCGCCACCATGCCATA CGATGTTCCAGATTACGCT-3¢ The XbaI restriction site-conjugated lower primer was 5¢-GCTCTAGAGCTCA TTTCCGACTGAAGA-3¢ Amplification of bcl-XL cDNA was ... was not able to activate the PtdIns3-K ⁄ Akt pathway, although it protected the cells from apoptosis induced by ADR Instead of activating this pathway, EGF stimulated the MAP kinase pathway and ... Tsukahara T, Kannagi M, Ohashi T, Kato H, Arai M, Nunez G, Iwanaga Y, Yamamoto N, Ohtani K, Nakamura M et al (1999) Induction of Bcl-x(L) expression by human T-cell leukemia virus type Tax through...
... calculate an output variable from other input variables and parameters The structural analysis by ISM classifies variables and parameters in accordance with the hierarchical levels, which are obtained ... the paths are replaced bya path corresponding to the product, and the intermediate variable is eliminated However, it may happen that an output variable is also used as an intermediate variable ... differential diagnosis or management of renal diseases Despite major technological advances, gray-scale renal US has remained largely unchanged since the 1970s It provides only basic anatomical data,...
... have demonstrated that a parser using simple general rules for disambiguating sentences can yield appropriate behavior for a large class of performance phenomena right a- ~soeiation, minimal attachment, ... shift-reduce table at each stage The combination of the stack, input, and state of the parser will be called a configuration and will be notated as, for example, Right Association Native speakers of ... the appropriate preterminal is assigned The differentiating property between this parser and that of Marcus is a slightly different one, namely, the property of qaaM-real-time operation By quasi-real-time...