gt for optimal viewing
Tài liệu Soft Computing for Optimal Planning and Sequencing of Parallel Machining Operations docx
... operation j performed by MUi on WLl in the kth time slot Define s ijl ϭ , if k k k ϭ 1; s ijl ϭ ϩϱ for infeasible i, j, k, l ; and s k ϭϩϱ if Σ x ijl ϭ for all j, k, l , i.e., for any ijl i particular ... performed by MUi on WLl in the kth time slot and define f ijl ϭϩϱ for infeasible i, j, k, l For example, let 1–3–2–6–4–7–8–5 be a feasible solution of a sequence of eight operations required for ... WL2 from the last cycle of operations For this partially completed workpiece, operations 1, 2, 3, 4, 5, 8, 9, 10, and 16 had been performed before it was transformed to WL2 At time 0, the machine...
- 34
- 402
- 0
Tài liệu Practical mod_perl-CHAPTER 16:HTTP Headers for Optimal Performance doc
... imported when we use Apache:: File Refer to the Apache::File manpage for more information 530 | Chapter 16: HTTP Headers for Optimal Performance This is the Title of the Book, eMatter Edition Copyright ... nature (as in a “form page for submittal”) and the creator of the page wants to make sure that the page does not get submitted twice 540 | Chapter 16: HTTP Headers for Optimal Performance This is ... responses that contain a Content-Length header In mod_perl we can write: $r->header_out('Content-Length', $length); When using Apache::File, the additional set_content_length( ) method, which is slightly...
- 12
- 398
- 0
Báo cáo khoa học: UMP kinase from the Gram-positive bacterium Bacillus subtilis is strongly dependent on GTP for optimal activity potx
... the following primers: 5¢-pyrH, 5¢-GGGGCATATGGAA AAACCAAAATACAAACGTATCGTATTA-3¢; and 3¢-pyrH, 5¢-CCCCCTCGAGTTATTTCCCCCTCACGA TCGTTCCGATTGATTCAC-3¢ The product was inserted between the NdeI and ... rate (%) ATP dATP GTP ITP CTP ATP + GTP dATP + GTP ATP + ITP dATP + ITP ATP + CTP ITP + GTP 0.7
- 9
- 328
- 0
Báo cáo hóa học: " MAC Protocols for Optimal Information Retrieval Pattern in Sensor Networks with Mobile Access" pptx
... therefore, the best performance The performance under this scheduler can be used as a benchmark for performance comparison For a given sensor location realization xN and a fixed m, the optimal dmax is ... are optimal for the circular field For the Aloha scheduling in both the linear field and the circular field, the optimal transmission probability is one and the optimal activation interval length ... Therefore, we have proved that, with the same throughput, the shorter the activation length, the better the performance Hence, the optimal Pi is and the optimal i is less than or equal to 1/ρ for...
- 12
- 241
- 0
báo cáo khoa học: " The Rx for Change database: a first-in-class tool for optimal prescribing and medicines use" ppt
... [7] For the Rx for Change database, the CC&CRG is responsible for maintaining and updating the evidence on the effect of consumer-targeted interventions, such as providing consumers with information ... using a standardised data extraction form and a consensus process This ensures a consistent summary format for each review and ensures the accuracy of the information Analysis and synthesis We ... Agency for Drugs and Technologies in Health (CADTH), for making this project possible We also thank the Canadian Institutes for Health Research, KT Canada, and the National Prescribing Service for...
- 9
- 245
- 0
Optimal cost and allocation for UPFC using HRGAPSO to improve power system security and loadability
... power transmission lines Figure 11 Performance index evolution of different approaches for case Figure 12 Performance index evolution of different approaches for case Table Simulation results of ... optimal power flow with DC load flow model [5] We also use the voltage profile and the transmitted power through the transmission line as the objective function for this test system to find optimal ... factor for ith bus respectively, S j , w j are apparent power and associated weighting factor for jth line respectively, Vref i is nominal voltage magnitude which is assumed to be 1pu for all...
- 16
- 547
- 0
Optimal placement of horizontal - and vertical - axis wind turbines in a wind farm for maximum power generation using a genetic algorithm
... configuration for placement of wind turbines to get the optimal value of the objective function for the entire wind farm; identical results were obtained by Grady et al [2] Figure 5(a) is the optimal ... mean and median objective valuses for Case I (b) Standard deviations for Case I (c) Best, mean and median objective values for Case II (d) Standard deviations for Case II Figure Convergence history ... median objective values for Case IV (d) Standard deviations for Case IV Figure Convergence history of the objective function (total power/cost) for VAWT wind farm using GA Figure Optimal layout of...
- 12
- 635
- 1
Tài liệu Báo cáo " Research on optimal silicon etching condition in TMAH solution and application for MEMS structure fabrication " ppt
... obtained results, the optimal conditions for etching silicon in TMAH were suggested Finally, a useful procedure for fabricating MEMS structure using beams as mechanical element (for example: MEMS ... the etchant seems to be optimal in the case when only a one-side aligner is available and the thermal SiO2 is used as the mask material The point will be especially useful for MEMS devices fabricated ... with sensitivities of - 20 Ω.cm, 260 ± 25 µm thickness were used for experiments The protection material was only SiO2 layer formed on two sides of silicon wafer by wet thermal oxidation In the...
- 7
- 461
- 0
Tài liệu Báo cáo khoa học: AcmA of Lactococcus lactis is an N-acetylglucosaminidase with an optimal number of LysM domains for proper functioning ppt
... CGCGAATTCTTATGTCAGTACAAGTTTTTG CGCGAATTCCTTATGAAGAAGCTCCGTC CTTCAACAGACAAGTCC AGCAATACTAGTTTTATA CGCGAATTCGCTAGCGTCGCTCAAATTCAAAGTGCG AGGAGATCTGCGACTAACTCATCAGAGG GCATGAATTCATCGCGAACTGCTATTGGTTCCAG GGTACTGCCGGGCCTCCTGCGG ... GCATGAATTCATCGCGAACTGCTATTGGTTCCAG GGTACTGCCGGGCCTCCTGCGG ACAACTGTTAAGGTTAAATCCGGAGATACCCTTTGGGCG TCAATTCATAAGGTCGTTAAAGGAGATACTCTCTGG AGCGGAATTCAATAATTTATTTTATTCGTAGATACTGACC EcoRI EcoRI EcoRI 2864 SpeI NheI ... repeats are required for optimal cell wall lytic activity of AcmA Cell separation and sedimentation Deletion of two and all three repeats had a clear effect on the chain length and sedimentation...
- 15
- 460
- 0
Tài liệu Báo cáo khoa học: "Unsupervised Search for The Optimal Segmentation for Statistical Machine Translation" doc
... normalization is performed including the newly added fractional counts (3) j=1 i=0 The sentence length probability distribution P (m|e) is assumed to be Poisson with the expected sentence length equal ... the segmentation no update is needed for c(fj |ei ) for j = N , j = p, q, i = M (note that fk no longer exists); and the necessary updates ∆c(fj |ei ) for c(fj |ei ), where j = p, q; i = ... used for translation evaluation Figure compares the translation performance obtained using the described segmentation methods All segmentation methods generally improve the translation performance...
- 6
- 445
- 0
Tài liệu Báo cáo khoa học: "Fast Decoding and Optimal Decoding for Machine Translation" doc
... observe a new sentence f, then an optimal decoder will search for an e that maximizes P(e f) Ô The symbols in this formula are: (the length of e), (the length of f), e (the i English word in ... can be transformed into a decoding problem instance, Model decoding is provably NP-complete in the length of f It is interesting to consider the reverse directionis it possible to transform a decoding ... test collection of 505 sentences, uniformly distributed across the lengths 6, 8, 10, 15, and 20 We evaluated all decoders with respect to (1) speed, (2) search optimality, and (3) translation accuracy...
- 8
- 440
- 0
Optimal Time for Collecting Volatile Organic Chemical Samples from Slowly Recovering Wells ppt
... APPENDIXES (published separately In Chou et 81.1991) A B Time Series Data for Determining Optimal Time for Sampling for Volatile Organic Compounds Base/Neutral and Acid Fraction Compounds Found ... protocol for sampling volatile organic compounds from wells finished in fine-grained materials, the optimal time for collecting the water sample had to be determined A major problem with sampling for ... volatile organic compounds is their loss from the sample before analysis To be conservative, we defined the optimal time for sampling for volatile organic compounds as the time when their concentrations...
- 22
- 463
- 0
Báo cáo khoa học: "Optimal rank reduction for Linear Context-Free Rewriting Systems with Fan-Out Two" pot
... Backward and local backward quantities for the expanded range can be expressed as a function of the same quantities for r Therefore if we store our quantities for previously processed ranges, each ... edges for r is defined as Br = {(x, x′ ) | (x, x′ ) ∈ Er , x ≺p r.left, x′ ∈ r} The set of forward edges for r is defined symmetrically as Fr = {(x, x′ ) | (x, x′ ) ∈ Er , x ∈ r, r.right ≺p x′ } For ... various grammatical formalisms In Proceedings of the 25th Meeting of the Association for Computational Linguistics (ACL’87) Daniel Gildea 2010 Optimal parsing strategies for linear context-free...
- 9
- 274
- 0
Báo cáo khoa học: " a Tool for Teaching by Viewing Computational Linguistics" potx
... of changing parameters for the LSA algorithm and visualizing the results, or as the integrated programs for the computational lexicons tool: ManageLex (http://nats-www informatik.uni-hamburg.de/view/ ... generated not only for the lessons, but also for the term dictionary associated to each module XML = Extensible Markup Language More details to be found on http://en.wikipedia.org/wiki/XML For the moment ... Development for Interactive Multimedia Training, Journal of Interactive Instruction Development, Volume 6, Number 3, p 18-31 Pete Thibodeau 1997 Design Standards for Visual Elements and Interactivity for...
- 4
- 331
- 0
Báo cáo khoa học: "Towards an Optimal Lexicalization in a Natural-Sounding Portable Natural Language Generator for Dialog Systems" pdf
... foundation for meaningful interaction in a given speech community.” (Fillmore et al., 2003, p 235) In FrameNet, lexical units are grouped in frames; frame hierarchy information is provided for each ... semantic roles For each frame, all the occurrences in the corpus are ordered according to their frequency for each separate valence pattern This model is then used as a comparator for all output ... generator with a dialog manager meaning representation (DM MR), which contains the content information for the answer Our research focuses on the lexicalization subcomponent of the microplanner...
- 6
- 301
- 0
Báo cáo khoa học: "Optimal Head-Driven Parsing Complexity for Linear Context-Free Rewriting Systems" docx
... an algorithm for finding the best parsing strategy, and Huang et al (2009) mention that whether finding the optimal parsing strategy for an SCFG rule is NPhard is an important problem for future ... be thought of as a type of query optimization for logic programming Query optimization for logic programming is NP-complete since query optimization for even simple conjunctive database queries ... briefly introduce LCFRSs and define the problem of optimizing head-driven parsing complexity for these formalisms For a positive integer n, we write [n] to denote the set {1, , n} As already mentioned...
- 10
- 302
- 0
Báo cáo khoa học: "An Optimal-Time Binarization Algorithm for Linear Context-Free Rewriting Systems with Fan-Out Two" ppt
... terminology and notation that we adopt for LCFRS; for detailed definitions, see (Vijay-Shanker et al., 1987) We denote the set of non-negative integers by N For i, j ∈ N, the interval {k | i ≤ k ... interval {k | i ≤ k ≤ j} is denoted by [i, j] We write [i] as a shorthand for [1, i] For an alphabet V , we write V ∗ for the set of all (finite) strings over V As already mentioned in Section ... can therefore conclude that our binarization algorithm runs in optimal time O(|p|) In order to run in constant time each single iteration of the while-loop at lines to 10, we need to perform some...
- 9
- 376
- 0
Báo cáo khoa học: "Optimal and Syntactically-Informed Decoding for Monolingual Phrase-Based Alignment" doc
... by DeNero and Klein (2008) for finding optimal phrase-based alignments for MT Exact Decoding via ILP Instead of resorting to approximate solutions, we can simply reformulate the decoding problem ... values for the model MANLI’s phrase-based representation makes decoding more complex because the segmentation of T1 and T2 into phrases is not known beforehand Every pair of phrases considered for ... shallow parser (Daum´ and e Marcu, 2005) for detecting constituents and employ only string similarity and WordNet for determining semantic relatedness, forgoing NomBank and the distributional...
- 6
- 184
- 0
Towards Instance Optimal Join Algorithms for Data in Indexes pdf
... different values for the attribute A, which we denote Ua = σA=a (R(A) S(A, B)) for each a ∈ A Our goal is to form the intersection Ua ∩ T (A) for each such a This procedure performs the same intersection ... instance -optimal join processing for restricted classes of queries We showed our results are optimal in the following senses: (1) Assuming the 3SUM conjecture, our algorithms are optimal for the ... ← the element in Yj forj ∈ Active s ← the max element, s ≤ lj forall j ∈ Active s ← be s’s successor in S (if s exists) If s does not exist then For j ∈ Active Emit lj θ s for θ ∈ {, =} else...
- 43
- 1,041
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25