glutathione metabolism and its contribution to antiapoptotic properties of a crystallins in the retina
báo cáo hóa học:" Daily physical activity and its contribution to the health-related quality of life of ambulatory individuals with chronic stroke" pot
... will in fact generate an increase in HRQL Page of All of the functional ability measures were found to correlate to the amount of PA, indicating that greater balance function and decreased motor ... Columbia & Rehab Research Lab, GF Strong Rehab Centre, Vancouver, Canada 2School and Graduate Institute of Physical Therapy, National Taiwan University, and Physical Therapy Center and Department of ... functional ability (motor impairments of lower extremity, balance and walking distance) of these individuals to the amount of daily PA they undertake This will enhance our understanding and identify...
- 8
- 384
- 0
Báo cáo y học: "Dynamic simulation of red blood cell metabolism and its application to the analysis of a pathological condition" docx
... oxidantinduced decrease of hexokinase and pyruvate kinase, and the maximum activity of these enzymes was allowed to change according to the ratio of GSH and GSSG The equations and parameters used are derived ... disposable cells never reach a mathematical steady state Thus, a model that can tolerate long-term simulation for analyzing the pathology of human diseases should not approximate the "mathematical ... Mathematical simulation and analysis of cellular metabolism and regulation Bioinformatics 1999, 15:749-758 Tomita M, Hashimoto K, Takahashi K, Shimizu TS, Matsuzaki Y, Miyoshi F, Saito K, Tanida...
- 11
- 386
- 0
distillation theory and its application to optimal design of separation units
... decades: Victoria Avetyan, Vyacheslav Kiyevskiy, Maya Yampolskaya, Valentina Mashkova, Galina Inyayeva, Elizaveta Vinogradova, Zhanna Bril, Boris Isayev, Alexander Shafir, and Oleg Karpilovskiy My ... both the theoretical and practical standpoints Among these problems is the problem of maximizing energy savings by optimizing the type of separation unit and by maximizing heat recovery and the ... obtained by other researchers, have been putting a great deal of effort into elaborating general methods of the geometric theory to answer the fundamental questions listed above An analysis of thermodynamically...
- 362
- 2,015
- 0
Báo cáo hóa học: " Research Article The Generalized Gronwall Inequality and Its Application to Periodic Solutions of Integrodifferential Impulsive Periodic System on Banach Space" potx
... Poincar´ operator P and give the e relation between T0 -periodic P C-mild solution and the fixed point of P After showing the compactness of the Poincar´ operator P and obtaining the boundedness of ... X As a result, P is a compact operator In order to use Leray-Schauder fixed pointed theorem to examine whether the operator P has a fixed point, we have to make assumptions H2.2 and H2.5 a little ... that the set K can be approximated to an arbitrary degree of accuracy by a precompact set Kε Hence K itself is a precompact set in X That is, P takes a bounded set into a precompact set in X As...
- 22
- 296
- 0
Protein s nitrosylation and its relevance to redox control of cell signaling
... Trx1 is cytosolic protein of Trx family In the reduced state, it binds to and inhibits ASK1, an activator of the c-Jun N-terminal kinase (JNK) and p38 MAPK kinase pathway Intramolecular disulphide ... cysteine, methionine, lysine, arginine, threonine and histidine and proline The hallmark of oxidative damage to the proteins is formation of protein carbonyls, and as a result, the protein carbonyls ... colorectal adenomas and carcinomas, ovarian carcinomas, malignant brain tumors and breast cancer tissues (Janssen AM et al, 1999) In addition to protein overexpression, increased activities of antioxidant...
- 213
- 354
- 0
Báo cáo y học: "Teaching child and adolescent psychiatry to undergraduate medical students - A survey in German-speaking countries"
... at each medical school focusing on a separate area: “examination and standards in examination,” “e-learning in medicine,” “evaluation of teaching,” “practical year,” and “preparation for final ... details about the amount of time they teach and the kind of examination they give A standardization of the examination across medical schools would be desirable to guarantee a predefined level of ... 33 academic departments of CAP in the German-speaking parts of Europe: 26 in Germany, in Austria, and in Switzerland After mailings and some personal reminders, the response rate was 100% Further...
- 8
- 538
- 0
Báo cáo Y học: Nuclear proteins that bind to metal response element a (MREa) in the Wilson disease gene promoter are Ku autoantigens and the Ku-80 subunit is necessary for basal transcription of the WD gene ppt
... using LA Taq (Takara, Japan) in a total volume of 50 lL containing 55 pg of competitor At this concentration, the band intensity of the amplified product from the competitor was same as that of ... bands are indicated by solid arrowheads Fig Microsequencing analysis of the MREa-binding proteins (A) The N-terminal sequence of the 82-kDa band was identical to amino-acid positions 6–16 of the ... proteins that bind specifically to MREa play an important role as a basal regulator of WD gene transcription MATERIALS AND METHODS Cell culture The human hepatoma cell line HepG2 was obtained...
- 11
- 628
- 0
báo cáo hóa học: " Occurrence of post traumatic stress symptoms and their relationship to professional quality of life (ProQoL) in nursing staff at a forensic psychiatric security unit: a cross-sectional study" potx
... wards Horizontal dotted lines indicate bottom quartile, median and top quartile from normative data in the ProQOL manual [16] and Figure 3, the separate distributions of scores for the wards of ... problems, and to a "natural briefing" of the staff, so that nothing is unexpected, and therefore fewer things are potentially traumatizing One can also speculate on if one of the treatment principles, ... making the patient treatable at a lower security level can explain the low compassion satisfaction scores at ward A, the admission ward At this particular forensic unit, patients transfer to a...
- 6
- 449
- 0
Báo cáo y học: "Ultrasound properties of articular cartilage in the tibio-femoral joint in knee osteoarthritis: relation to clinical assessment (International Cartilage Repair Society grade)" pptx
... out of the 20 knees had all the data of grade cartilage at sites A, B and E, the signal intensity of the grade cartilage of sites A, B and E was also compared in the 11 knees using the nonparametric ... was maintained in cartilage of the lateral condyle (site A and site B) but deteriorated in cartilage of the medial condyle (site C), in cartilage at the central load-bearing region in the lateral ... than that of grade cartilage (Figure 3e), but that of grade cartilage and grade cartilage did not differ from that of grade cartilage Although these data for grade cartilage and grade cartilage...
- 9
- 358
- 0
SOME INTERESTING PROPERTIES OF WHILE HOLE IN THE VECTOR MODEL FOR GRAVITATIONAL FIELD
... Quasars have the properties as follows([5]) - Quasars have the high red shift, - Quasars have the sizes are small by observed data, - Quasars have the variation of the brightness in the optical ... DISCUSSION AND CONCLUSION With the strange properties of the while holes as above discussion, what can the candidates of while holes be ? In our opinion, the candidates of while holes can just be quasars! ... WHILE-BLACK HOLE We this section we shall consider radial motion of a particle into a while- black hole We consider a particle falling radially into the central body with the particle having a velocity...
- 6
- 297
- 0
wo3 thin film sensor prepared by sol–gel technique and its low-temperature sensing properties to trimethylamine
... The working pressure in the analysis chamber was maintained below × 10−7 Pa during the specimen analysis To eliminate the effect of sample surface charging the shift of the XPS peak of carbon (C ... sensitivities to TMA, C2 H5 OH gas, gasoline, CH4 , CO, and water vapor were measured A given amount of each gas was injected into the chamber and mixed by a fan for 30 s The sensitivity to gases, S, ... defined as S = V g /V a , where Vg and Va are the voltage drops across the load resistance in testing gases/air mixture and in air, respectively Fig X-ray diffraction patterns of the thin films annealed...
- 4
- 407
- 0
Báo cáo lâm nghiệp: "Strength properties of thermally modified softwoods and its relation to polymeric structural wood constituents" pot
... perpendicular to the grain (radial and tangential) is much lower than parallel to the grain (longitudinal) The presence of different types of bonds, strong and stiff bonds along the chain axis and weak and ... load-sharing capacity of the lignin-hemicelluloses matrix, and increase of the relative amount of crystalline cellulose could contribute to the increase of the MOE The increased cross linking of the ... level); and fiber -to- fiber bonding with the middle lamella acting as the adhesive (macroscopic level) According to Sweet and Winandy [45] wood fibres can be regarded as a composite material and a single...
- 12
- 365
- 0
Development of the Quantitative PCR Method for Candidatus ‘Accumulibacter phosphatis’ and Its Application to Activated Sludge
... (5'!3') AGAGTTTGATCCTGGCTCAG GGCTACCTTGTTACGACTT CTGGAGTTTGGCAGAGGG GTTAGCTACGGCACTAAAAGG CCGTCATCTACWCAGGGTATTAAC CCCTCTGCCAAACTCCAG GTTAGCTACGGCACTAAAAGG GCTGCCTCCCGTAGGAGT GCAGCCACCCGTAGGTGT ... Quantification using Quantitative PCR and FISH method in Activated sludge The amount of Candidatus ‘Accumulibacter phosphatis’ in the laboratory-scale and the full-scale activated sludge were quantified ... DNA extracted from activated sludge were evaluated In addition, the amount of Candidatus ‘Accumulibacter phosphatis’ in laboratory-scale EBPR and full-scale activated sludge samples were quantified...
- 7
- 719
- 0
Tài liệu Báo cáo khoa học: Insights into and speculations about snake venom metalloproteinase (SVMP) synthesis, folding and disulfide bond formation and their contribution to venom complexity pdf
... and 365 respectively, N-terminal to the unpaired cysteinyl residues observed in jararhagin and catrocollastatin Jarahagin and catrocollastatin are known to undergo post-translational processing ... associated with the structure of the adjacent proteinase and disintegrin-like domains and the packing of those two domains together in the structure Comparison of the sequences in the spacer domain ... bond pairs located in the center and in the C-terminal region of the domains are shared between the disintegrin flavoridin and VAP1 The disulfide bond patterns of the disintegrins and disintegrin-like...
- 15
- 476
- 0
Tài liệu Báo cáo khoa học: Identification of ATP-NADH kinase isozymes and their contribution to supply of NADP(H) in Saccharomyces cerevisiae docx
... ACCACTTTGTACAAGAAAGCTGGGT CAATAAATCTGCTTACGTGACATTTTTTACTAAAAGAGAAT ATGCGTACGCTGCAGGTCGAC GAACCCTTGACTACGGAAACGCAGGATGTGGGAAATCG TTAATCGATGAATTCGAGCTCG CATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAA ATGCGTACGCTGCAGGTCGAC ... ATGCGTACGCTGCAGGTCGAC CTTAGAGAATCTCATTGAATCTTTGCATTCAGAGCGT TTAATCGATGAATTCGAGCTCG CATAAATAAAAGGATAAAAAGGTTAAGGATACTGATTAAA ATGCCAATTCTGTGTTTCCCGGAAATG CTTAGAGAATCTCATTGAATCTTTGCATTCAGAGCGT TTAGTAAAGTTCGTTTGCCGATACATG ... cerevisiae is underlined Primer Oligonucleotide sequences yef1-attB1FSD AAAAAGCAGGCTCCGAAGGAGATATAAAA ATGAAAACTGATAGATTACTG AGAAAGCTGGGTGGATTGCAAAATGAGCCTGAC ACAAGTTTGTACAAAAAAGCAGGCT ACCACTTTGTACAAGAAAGCTGGGT...
- 13
- 560
- 0
Tài liệu Báo cáo khoa học: "Organizing Encyclopedic Knowledge based on the Web and its Application to Question Answering" ppt
... method can be used in a number of applications, including human usage, thesaurus production (Hearst, 1992; Nakamura and Nagao, 1988) and natural language understanding in general a) binary trees, ... Proceedings of the 33rd Annual Meeting of the Association for Computational Linguistics, pages 189–196 Yuji Matsumoto, Akira Kitauchi, Tatsuo Yamashita, Yoshitaka Hirano, Osamu Imaichi, and Tomoaki ... Artificial Intelligence, pages 662–667 Dan Moldovan and Sanda Harabagiu 2000 The structure and performance of an open-domain question answering system In Proceedings of the 38th Annual Meeting of the...
- 8
- 508
- 1
Tài liệu Báo cáo khoa học: "AUTOMATIC SPEECH RECOGNITION AND ITS APPLICATION TO INFORMATION EXTRACTION" pdf
... people, and organizations and all manner of relations among them The great richness of material and the naturally evolving content in broadcast news has leveraged its value into areas of research ... obtained world domain of obvious value has lead to rapid technology transfer of speech recognition into other research areas and applications Since the variations in speaking style and accent as ... Japanese characters (Hira-gana and Kata-kana) Most Kanji have multiple readings, and correct readings can only be decided according to context Conventional language models usually assign equal...
- 10
- 515
- 3
The Savings and Loan Crisis and Its Relationship to Banking pptx
... deregulation and forbearance would accrue to the owners and managers of the savings and loans The S&L crisis overlapped several regional banking crises in the 1980s and at first was similar to the ... over its regulators and if the regulators have the ability to hire, train, and retain qualified staff In this regard, the bank regulatory agencies need to remain politically independent Third, the ... requirements and the ability to acquire an institution by contributing in- kind capital (stock, land, or other real estate), invited new owners into the industry With a minimal amount of capital, an S&L...
- 22
- 446
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008