genetic engineering of the plant cell factory for secondary metabolite production indole alkaloid production in catharanthus roseus as a model
The Use of Plant Cell Biotechnology for the Production of Phytochemicals
... A Kirakosyan et al 2.1 Plant Cell Factories as a Source of High-Value Metabolites The presence of valuable metabolites in plants has stimulated interest on the part of industry in the fields of ... consequence of this metabolic engineering manipulation, the amount of violaxanthin was diminished dramatically, and in some cases, the monoepoxy intermediate, antheraxanthin, accumulated (Romer et al., ... may play a key role in preventing secondary metabolites from being catabolized Catabolism thus may be an important factor in metabolic engineering A remarkable observation was made in plant cell...
- 19
- 759
- 1
Báo cáo y học: " Ageing, autoimmunity and arthritis: Senescence of the B cell compartment — implications for humoral immunity" pptx
... Unfortunately, a paucity of information exists regarding the nature of the B cell compartment in these same individuals Available evidence suggests that the total number of B cells declines as ... described in aged mice As one can easily imagine, experiments using human BM are exceptionally challenging for a variety of reasons Adult marrow specimens are often of limited availability and rarely ... the low numbers of patients examined and/or the use of data presentation in which means were calculated for groups containing individuals that differed in age by as much as 26 years Because aging...
- 9
- 432
- 0
Báo cáo y học: "Genetic characterization of the cell-adapted PanAsia strain of foot-and-mouth disease virus O/Fujian/CHA/5/99 isolated from swine" doc
... with the porcinophilic properties that caused a catastrophic outbreak of FMD in Taiwan [12-14] The O /AS/ SKR/2002 strain, a member of the PanAsia lineages, contains an intact 3A coding region of the ... countries and districts of East Asia (EA) and the Far East [11] The O/ YUN/TAW/97 strain, a member of the Cathay topotype, containing the deletion of codons 93 to 102 in 3A coding region, is associated ... cannot account for the characteristics of the PanAsia strains isolated from China (as detailed in Results & Discussion) Here, we first report the cell- adapted PanAsia strain (O/Fujian/CHA/5/99) of...
- 11
- 383
- 0
Báo cáo y học: " A polymorphism in the interleukin-4 receptor affects the ability of interleukin-4 to regulate Th17 cells: a possible immunoregulatory mechanism for genetic control of the severity of rheumatoid arthritis" doc
... Yanagihara Y, Mao XQ, Gao PS, Arinobu Y, Ihara K, Takabayashi A, Hara T, Enomoto T, Sasaki S, Kawai M, Hamasaki N, Shirakawa T, Hopkin JM, Izuhara K: Cutting edge: dominant effect of Ile50Val ... various durations of RA Severity was not calculated on the basis of the rate of accumulation of joint damage over a specific interval of time, and therefore an effect of I50V on severity may have been ... Lira SA, Gorman D, Kastelein RA, Sedgwick JD: Interleukin-23 rather than interleukin-12 is the critical cytokine for autoimmune inflammation of the brain Nature 2003, 421:744-748 Murphy CA, Langrish...
- 9
- 472
- 0
Báo cáo sinh học: "Quantitative estimation of genetic risk for atypical scrapie in French sheep and potential consequences of the current breeding programme for resistance to scrapie on the risk of atypical scrapie" pptx
... exposure, increasing frequency of the ALRR allele in the general population should not result in an increase of the global AS prevalence in the sheep population Despite the low prevalence of AS in ALRR-ALRR ... flock to have at least one AS case detected according to the number of animals tested Plain line: median of probability, dashed lines: 95% credibility interval of probabilty Page of cases and controls ... AS in ALRR-ALRR animals is strategically important to assess the impact of current breeding programmes on the AS prevalence in the general population In France, breeders of flocks participating...
- 7
- 300
- 0
Genetic analysis of the role of ARP2 3 complex in border cell migration in drosophila melanogaster
... Domains organization in WASPs and WAVEs and the regulation mechanisms a Domain organizations in WASPs All WASPs contains a WCA domain at C terminal b Intracellular inhibition in WASPs and the ... masked by intramolecular interaction or by an associated protein complex WASP and N-WASP contain a Cdc42/Rac GTPase binding domain (GBD), linking cellular signals that activate Cdc42 to the actin cytoskeleton ... nucleation model of actin assembly Upon activation by WASp and Scar/WAVE, Arp2/3 complex nucleates a branched actin filament at the side of an existing actin filament Arp2/3 associates with the...
- 133
- 355
- 0
Genetic engineering of hybrids of major mite allergens of dermatophagoides pteronyssinus and evaluation of their potential as vaccines for immunotherapy
... pairs Primer AFTF DP1F DP2F DP2R DP5F DP5R DP7F DP7R Sequence ACCGGGCTTCTCCTCAACCATGGCG GAGAATGACAACATATGGATATTC GATCAAGTCGATGTCAAAGATTGTG TCAATCGCGGATTTTAGCATGAG GAAGATAAAAAACATGATTATCAA TTAAACTTCAATCTTTTTAACACGTGC ... genetic engineering The cDNA encoding the individual components are assembled together by polymerase chain reaction (PCR) and the resultant constructs are expressed as a single recombinant protein As ... Incidence of Allergy The incidence of allergic diseases has risen dramatically over the last two decades in western Europe, the United States and Australasia (Mackay and Rosen, 2001), affecting up...
- 112
- 179
- 0
Development of the Quantitative PCR Method for Candidatus ‘Accumulibacter phosphatis’ and Its Application to Activated Sludge
... (5'!3') AGAGTTTGATCCTGGCTCAG GGCTACCTTGTTACGACTT CTGGAGTTTGGCAGAGGG GTTAGCTACGGCACTAAAAGG CCGTCATCTACWCAGGGTATTAAC CCCTCTGCCAAACTCCAG GTTAGCTACGGCACTAAAAGG GCTGCCTCCCGTAGGAGT GCAGCCACCCGTAGGTGT ... copies of the DNA quantification standard per reaction A linear regression line of the Ct values for the DNA standards versus logarithm of their starting copy number was constructed A typical linear ... measured with image analysis software (Qwin, Leica) The ratios of PAOMIX-positive cells (Candidatus ‘Accumulibacter phosphatis’) to eubacterial cells were decided based on those areas RESULTS AND...
- 7
- 719
- 0
Validity of the achievement written test for non major, second year students at economics department, hanoi open university
... Japanese rivals passive: The use special Matching The She always Make these active plastic instead of comes up with new sentences passive ideas… metal c ….I wish I was 10 The first and as creative ... lot of care as well as attention Objective tests are applied in many of national examinations, which bring a lot of advantages for both candidates and organizers However, at ED, HOU, most of the ... training ED is one of the very first departments established at the same time of HOU There are teachers of English at ED, half of them have gained their master degrees, and the rest are doing their...
- 39
- 490
- 0
Tài liệu THE FUTURE OF THE WILD Radical Conservation for a Crowded World ppt
... something you can measure So talk of the scale of a leaf or a landscape makes no sense How big is a leaf ? Some leaves are as big as your thumbnail; others are as long as your arm The landscape for ... preserve in a State or National Park, a complete replica on a small scale of the flora and fauna of a much larger area.” You cannot make a Xerox reduction of nature and stash it away in some remote ... statute but in a myriad of laws, including the Endangered Species Act, the National Environmental Policy Act, the National Forest Management Act, and others In the case of the spotted owl, the...
- 292
- 531
- 0
Tài liệu Báo cáo khoa học: Crystal structure of thiamindiphosphate-dependent indolepyruvate decarboxylase from Enterobacter cloacae, an enzyme involved in the biosynthesis of the plant hormone indole-3-acetic acid doc
... mobility of the domains in the crystal; the PYR domain has the lowest average B-factor, ˚ 23 A2 (comparable to the B-factor of bound ThDP), whereas the middle domain has the highest overall B-factor, ... function and the estimated solvent content [20] indicate that the asymmetric unit contains four subunits, arranged as a tetramer The structure of a dimer of ZmPDC was used as a search model, as calculation ... with a role of this helix in closure of the active site [36] A model of the a- carbanion/enamine intermediate of the substrate indole- 3-pyruvate with ThDP in the active site of IPDC was built based...
- 10
- 557
- 0
FAQs Tuberculosis Component of the Technical Instructions (TIs) for the Medical Examination of Aliens in the United States doc
... is Class A Pulmonary TB Disease, Active, Infectious? In Class A Pulmonary TB, the applicant has an abnormal chest radiograph suggestive of active TB disease (see Appendix B in the TB TIs), and ... signature indicates the applicant is free of Class A pulmonary TB disease 22 Can the civil surgeon medically clear the applicant for TB even if the applicant is classified as “Class B1–Extrapulmonary ... TB disease 15 What is Class B2–Pulmonary TB, Inactive? In Class B2–Pulmonary TB, the applicant has an abnormal chest radiograph suggestive of inactive TB disease (see Appendix B in TIs), and no...
- 8
- 474
- 0
Báo cáo khoa học: Identification of the structural determinant responsible for the phosphorylation of G-protein activated potassium channel 1 by cAMP-dependent protein kinase pdf
... result of other protein kinases masking the PKA-catalysed part Indeed, protein kinases other than PKA, including 6222 tyrosine kinases, have been demonstrated to directly phosphorylate GIRK1 [12] The ... with a PKA inhibitor and also in untreated oocytes On the other hand, the in vitro phosphorylation signal was markedly diminished when SpCAMPS, a PKA activator, was injected, indicating that the ... microgram of the appropriate protein was incubated in 300 lL of PhB containing 18.5 kBq [32P]ATP[cP] and 0.4 lL of PKA-cs for 30 at room temperature (agitated by a Labquake laboratory shaker;...
- 9
- 403
- 0
Báo cáo khoa học: Increased NADPH concentration obtained by metabolic engineering of the pentose phosphate pathway in Aspergillus niger docx
... Performing partial least square (PLS) regressions For future metabolic engineering of strains with the purpose of obtaining increased NADPH levels and for the understanding of the regulation of ... the high NADPH concentration The lack of a significant increase in NADH parallel to the increase in NADPH indicates that there is no significant transhydrogenase activity in A niger under the conditions ... position of the samples in Fig 4A is in uenced by the level of all variables in these samples For example, the samples of the strains in the third quadrant of Fig 4A have a tendency to a high erythritolI...
- 13
- 382
- 0
Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc
... GCTGGAGATGATCGTGCT-3¢ (Strep-tag underlined), then a secondary amplification with primers 5¢-CACCAC CACCACCACCACGAAGCTGGAGATGATCGTGCT-3¢ (His-tag underlined) or 5¢-TGGAGCCACCCGCAGTTCG AAAAAGAAGCTGGAGATGATCGTGCT-3¢ ... CAGTGGTGGTGGTGGTGGTGTCCAAAGAAGCTTG GGTCGTAT-3¢ (His-tag underlined); PSAG with a C-terminal Strep-tag (PSI-G-StrepTerm), 5¢-GCGGAGCTCAT GGCCACAAGCGCATCAGC-3¢ and 5¢-GCGGCATGCT CATTTTTCGAACTGCGGGTGGCTCCATCCAAAGAA ... a primary amplification with primers 5¢-GCGGAGCTCATGGCCAC AAGCGCATCAGC-3¢ and 5¢-GTGGTGGTGGTGGTGG TGGAAATGGGTTTTTCCGTTCTGC-3¢ (His-tag underlined) or 5¢-TGGAGCCACCCGCAGTTCGAAAAAGAA GCTGGAGATGATCGTGCT-3¢...
- 9
- 422
- 0
Sony vs. Samsung: The inside story of the electronics' giants battle for global supremacy
... products as well as for its global management I was fascinated by the late Akio Morita’s book, Made in Japan, and was impressed by his global mindset and business acumen This had led me to a research ... of Asiabased companies In many cases, these companies are still owned and managed by their founders or founders’ families In many cases the transition to professional managers that is typical in ... other Asian companies The History and Business Areas of Sony and Samsung Electronics Sony The King of AV In 1946, the year after Japan’s defeat in World War II, Sony was incorporated as the Tokyo...
- 490
- 705
- 1
Báo cáo khoa học: Restriction point control of the mammalian cell cycle via the cyclin E/Cdk2:p27 complex doc
... of the mammalian cell cycle using a yeast-like core model of the cyclin–Cdk interactions (emphasizing the deep similarities of the Cdk-regulatory systems of yeast and mammalian cells) They extended ... within the network The retinoblastoma and E2F transcription factor interactions which were coded as steady-state algebraic equations in the original model were coded explicitly as ODEs, increasing ... involved in the bistable switch in the Yao model Thus, according to our analysis of the model of Novak and Tyson, taken together with the summation theorem, the interplay between retinoblastoma and...
- 11
- 522
- 0
Báo cáo khoa học: Functional and genetic characterization of the promoter region of apolipoprotein H (b2-glycoprotein I) ppt
... support for the genetic basis of b2GPI plasma variation, but the exact molecular basis of this variation remains largely unknown b2GPI is suggested to regulate thrombin inactivation by heparin cofactor ... vector The APOH–PCR DNA was then ligated to the gelpurified and calf intestinal alkaline phosphatase-treated pGL3-basic vector by T4 DNA ligase to generate the fusion vector construct carrying the APOH ... levels of basal transcriptional activity when transfected into either COS-1 or HepG2 cell lines These results indicate that all of the necessary machinery for driving basal APOH expression is localized...
- 13
- 404
- 0
Office of the Deputy Inspector General for Auditing FY 2013 Audit Plan ppt
... related to the reliability of the financial reporting and compliance with laws and regulations that pertain to the financial statements Department of the Army Working Capital Fund Basic Financial ... Evaluate the effectiveness of planning, funding, and managing of base operations and infrastructure support for Task Force-East facilities U.S Transportation Command’s Readiness for the Drawdown ... cost and availability of spare parts for the C-27/G222 will allow for continued sustainability of the aircraft for the Afghan Air Force Datron Radio Contracts to Support the Afghan National Security...
- 54
- 563
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25