format title as you would for text in a cell so as not to obscure your sparkline
small business in paradise, working for yourself in a place you love (2007)
... owners have been caught in a real estate bubble that has driven up the cost of maintaining a B&B As a result, many area B&Bs have reverted to being private homes As daunting as that sounds, some ... transition to winemaking “If you make a decent wine, people will find you, ” says David “The knowledge you get from planting a vineyard and making wine as an amateur is invaluable.” Making wine ... Vineyard Management again to manage and harvest the vineyard, and construction was begun on a new winery and tasting room Meanwhile, they sold shares in the winery to private investors to help finance...
- 242
- 676
- 0
small business in paradise, working for yourself in a place you love (2007)
... owners have been caught in a real estate bubble that has driven up the cost of maintaining a B&B As a result, many area B&Bs have reverted to being private homes As daunting as that sounds, some ... transition to winemaking “If you make a decent wine, people will find you, ” says David “The knowledge you get from planting a vineyard and making wine as an amateur is invaluable.” Making wine ... Vineyard Management again to manage and harvest the vineyard, and construction was begun on a new winery and tasting room Meanwhile, they sold shares in the winery to private investors to help finance...
- 242
- 542
- 0
Báo cáo khoa học: " Application of ventriculoperitoneal shunt as a treatment for hydrocephalus in a dog with syringomyelia and Chiari I malformation" pptx
... netfo tsom si ydalam siht dna sulahpecordyh latinegnoc ot desopsiderp era sauhauhihC aixata htiw detneserp saw muiravlac depahs-emod a htiw god auhauhihC a ,esac siht nI ]3[ erusserp lainarcartni ... tcudeuqa cilahpecnesem deworran a evlovni sulahpecordyh latinegnoc fo sesac rehtO etar etauqeda na ta FSC brosbaer ot illiv dionhcara eht fo eruliaf ot eud yltnerappa giF si sulahpecordyh )latinegnoc( ... noitamroflam I iraihC taht detroper evah srepap emoS esac siht ni sredrosid lacinilc eht ot etubirtnoc ton did aileymognirys dna noitamroflam I iraihC taht dna sulahapecordyh fo tluser a ylniam saw aixata...
- 4
- 384
- 0
OPPORTUNITIES FOR TENANTS IN A DOWN MARKET
... bottom line CB Richard Ellis | Page 33 The Range of Options Subleasing Rental holidays Asset sales Sale and leasebacks Improving space utilisation Consolidate and co-locate Dropping swing space ... Assist you in dropping excess space in the process or helping to consolidate your offices Help you to renegotiate your current lease either to extend or to get out Has the local knowledge to navigate ... City Tower Opera Business Center, Asia Tower, Vietcombank Tower *Buildings are not listed in any particular order within rental ranges CB Richard Ellis | Page 13 63 Ly Thai To, Central Building,...
- 45
- 331
- 0
Báo cáo khoa học: "Searching for Topics in a Large Collection of Texts" doc
... a sort of machine learning, using a small manually annotated collection of texts When optimized -parameters are used, the Local Search procedure tries to simulate the behavior of human annotator ... Proceedings of the International Symposium on Information and Communication Technologies, pages 311–316 Trinity College Dublin, Ireland JAMA 2004 JAMA: A Java Matrix Package Publicdomain, http://math.nist.gov/javanumerics/jama/ ... human annotator who finds topically coherent clusters in a training collection The task of -optimization leads to a system of linear inequalities, which we solve via linear programming As there is...
- 6
- 447
- 0
beyond rationality the search for wisdom in a troubled time jan 2007
... of information has led directly to an increase in the number of passive observers of information, those who have to separate all the interlocking and contradictory pieces of (uncertain) information ... what we have always wanted Now we have extraordinary means of acquiring more information than we can process The increase in the amount and complexity of information coming at us creates joy as ... to see that if you are a bureaucrat with many people vying for your attention, and you want to be as accurate as possible, you will favor maximizing, for it maximizes the number of accurate predictions...
- 363
- 189
- 0
Báo cáo hóa học: "Distress or no distress, that''''s the question: A cutoff point for distress in a working population" pptx
... regarded as unfavorable for several reasons The first reason is the imminent concomitance of distress and sickness absence Distress as a main cause of sickness absence can be labeled under 'adjustment ... point can be used as a valid estimator for the prevalence of distress across demographic and occupational subgroups [29] A well-founded cutoff point can be used as a criterion to classify cases for ... Changing appraisal processes and enhancing coping skills are the fundaments for coping with stress more effectively Therefore, learning a method for managing demands and stressors, and altering...
- 8
- 396
- 0
Báo cáo sinh học: " Research Article Improved Noise Minimum Statistics Estimation Algorithm for Using in a Speech-Passing Noise-Rejecting Headset" pptx
... adaptation In addition, a new algorithm using adaptive filtering with averaging (AFA) is also verified The main advantages of AFA algorithm could be summarized as follows: high convergence rate comparable ... capability, as sharp change in angle grinder noise characteristics is noticed Using subwindows makes noise estimate updating faster and enables tracking jumps in the noise power Another point is that a ... SNR case, the worst case analyzed here, Table indicates that the method has achieved 2.6 db improvement The same case in Table shows 6.2 db increase in segmental SNR Meaning that multiband algorithm...
- 11
- 344
- 0
Báo cáo y học: "Sales of antidepressants, suicides and hospital admissions for depression in Veneto Region, Italy, from 2000 to 2005: an ecological study" doc
... decrease affected both the age strata 16-64 and 65+ age band, as well males and females The data relating to the 0-14 age strata are not reliable due to the small numbers involved This finding ... may have led to an increase in AD prescribing Our findings are more in line with the data examined by Isaacson and colleagues [5,6], and Barbui and colleagues [7] where suicide rates showed an ... prescribed and used for depression This is not entirely true, as antidepressants are increasingly used for anxiety disorders as well, and this is the case in Italy [29] Anxiety disorders are at least as...
- 18
- 383
- 0
Báo cáo sinh học: " Expected efficiency of selection for growth in a French beef cattle breeding scheme. I. Multistage selection of bulls used in artificial insemination" docx
... easily explained by the fact that uncertainty was only considered for preweaning parameters Sampling standard deviations of differentials for Hs are in the range of uncertainty in maternal variance ... was modified to take maternal performance into account: a combined index of the average W210 of 30 sons and the average W120 of calves of bulls’ daughters was built It was assumed that heritability ... capacity For the simplified scheme, standard deviations increase when progeny test capacity increases More males are evaluated on maternal performance and thus the uncertainty in preweaning parameters...
- 22
- 373
- 0
Báo cáo sinh học: "Expected efficiency of selection for growth in a French beef cattle breeding scheme. II. Prediction of asymptotic genetic gain in a heterogeneous population" docx
... constructed to evaluate sampling variances and covariances between preweaning genetic parameters (Phocas et al, 1995) The sampling variance-covariance matrix is derived for 4050 observations originated ... genetic parameters, at least as far as direct and global responses are considered The uncertainty in maternal genetic response is intermediate between uncertainty in maternal (co)variances (33%) and ... differentials in order to calculate the asymptotic genetic gain These weightings are generally derived for special situations James (1977) gave an analytical expression for the steady-state genetic gain...
- 18
- 304
- 0
Báo cáo y học: "Human cyclin T1 expression ameliorates a T-cell-specific transcriptional limitation for HIV in transgenic rats, but is not sufficient for a spreading infection of prototypic R5 " ppt
... not translate into an enhanced viral gene expression in this primary cell type, and already macrophages from n-tg rats are at a level comparable to human MDM This may, in part, relate to the ability ... GFP-expressing cells were comparable to those observed in infected human Tcells analyzed in parallel, while the latter typically showed a faster kinetic (Fig 8A and data not shown) Parallel sampling of ... manuscript, and to Gary Howard for editorial assistance We thank Dr Heiko Becher for statistical support and Reinhold Schmitt and Silvio Krasemann for animal handling This work was supported...
- 19
- 263
- 0
Báo cáo y học: "Assessment of balance and risk for falls in a sample of community-dwelling adults aged 65 and older" potx
... counseling to tobacco users.) Data management and analysis Data were entered into an SPSS (Version 12.0 for Windows) database Quality control was performed by the principal investigator by reviewing ... compare participants weeks after baseline to assess changes in balance scores as measured by the Berg Balance Scale, One Leg Standing Test and the Activities-specific Balance Confidence scale ... drugs Falls and balance Of the 101 participants, 13% reported having had a fall within the past month, and 44% within the last year The average number of reported falls for the last year was 0.8;...
- 8
- 372
- 0
Báo cáo y học: " A retrospective cohort pilot study to evaluate a triage tool for use in a pandemic" pps
... for Mass Critical Care: Definitive care for the critically ill during a disaster: a framework for allocation of scarce resources in mass critical care: from a Task Force for Mass Critical Care ... for Mass Critical Care: Definitive care for the critically ill during a disaster: medical resources for surge capacity: from a Task Force for Mass Critical Care summit 23 24 25 meeting, January ... Exclusion criteria/MQS triaged blue Total Medical care (%) 1 Awaiting cc/rehab Discharged N (%) N /A N /A N /A N /A N /A N /A N /A N /A N /A N /A N /A N /A (3.3) N /A N /A (5.9) 63 N /A N /A 20 N /A N /A N (%) Life...
- 9
- 271
- 0
High achieving pupils’ experiences of Assessment for Learning in a mainstream junior school: a qualitative case study drawing on perspectives from psychoanalytic theories
... the continuing debates regarding Assessment for Learning indicating that AfL remains a major topic internationally in education – it has not been a passing fad This thesis seeks to make a contribution ... theoretical position which, according to Stobart (2008, p 150) ‘seeks to hold in balance learning as a cultural activity and as individual meaning-making’, underpins an understanding of formative assessment ... to investigate contexts where teachers are employing formative assessment as an integral part of their day -to- day teaching: in busy primary school classrooms… in doing so there will be value in...
- 184
- 320
- 0
A study on strategies to improve writing skills for academics in a paragraph
... writing reflecting the interests of language teachers This paper is intended as a plea to restore teaching writing to its proper place in general, and the importance of writing a good paragraph in ... writing in foreign language teaching and the lack of interests in it John Carroll’s “Research on Teaching in Foreign Language” reports research on grammar, pronunciation, vocabulary, and reading ... writing skills for academics in a paragraph The first part of the paper seeks to examine the importance of how to write a good paragraph in teaching foreign language The second part of the paper...
- 10
- 475
- 1
Health and lifestyle risk factors for falls in a large population-based sample of older people in Australia
... Australian community care Canberra: Commonwealth of Australia Australian Institute of Health and Welfare (2007) Older Australia at a glance (4th ed.) Canberra: Australian Institute of Health and ... likely to have multiple falls As individuals age, the number of fall-related risk factors increase, contributing to the increased rate of fall-related injuries (O'Loughlin et al., 1993) In general, ... Health and Welfare, 2007) Individuals using four or more medications had an increased risk of falling compared to non-fallers and of having multiple falls compared to a single fall Polypharmacy...
- 7
- 323
- 0
Simplified fatigue assessment of offshore wind support structures accounting for variations in a farm
... analyses to several locations in an OWF under combined variations This is achieved by formulating a case study and applying the correction factors that are introduced (but not applied) in Chapter ... several locations cannot be a stand-alone process The effect of site variations can be accurately captured only when a detailed assessment at a certain location serves as the starting point The analysis ... that parameters that cause fatigue damage through the same mechanisms are treated as a separate block This prevents a global re-usage of the analysis when only certain fatigue parameters change...
- 126
- 370
- 0
Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot
... no real match to the original cell adapted variant, TUL02, it terms of fitness Taking into account that the in situ formed recombinant S RNA disappeared from the mixture after four passages [11], ... Gilljam M, Kanerva M, Manni T, Pejcoch M, Niemimaa J, Kaikusalo A, Henttonen H, Vaheri A, Plyusnin A: Isolation and characterization of Tula virus: a distinct serotype in genus Hantavirus, family ... (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855) To monitor the presence of recTULV S RNA, RT-PCR was performed with primers RECF738 (5'GCCAGAGAAGATTGAGGCATTTC3'; nt 738–760) and Page of (page number not...
- 5
- 483
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008