... and the ability to link these data to higher-education databases makes it easier to gather this data today To further leverage these advances, a mechanism needs to be established that can gather ... taught and often are not an active part of faculty professional development plans (Lueddeke 2008; Diamond and Adam 2004) At a time when the costs ofa university education are soaring and state ... the United States and Canada supported by the Carnegie Foundation for the Advancement of Teaching, the authors of Educating Lawyers: Preparation for the Profession of Law (Sullivan et al 2007) recommend...
... Isrina Oktavia Salasia et al reactions and with a commercial grouping kit (Slidex Strepto-kit bioMerieux, Nürtingen, Germany) The growth pattern ofthe bacteria in fluid media and the morphology of ... and with compact colonies in soft agar The growth properties of these three bacteria obtained from the original outbreak had already been described [15] According to studies of Abdulmawjood and ... (Biolabs, Schwalbach, Germany) [1] The preparation and SmaI digestion ofthe chromosomal DNA for macrorestriction analysis ofthe isolates by pulsed-field gel electrophoresis was performed as described...
... two players choose any pair of complement strings (except for the pair 11 10 and 00 01), then the third player can always attain an advantage by choosing a particular string Before we proceed, ... has the same or better chance of occurring before σ1 and σ2 Proof The proof can be shown in a similar fashion to that of Theorem 2, so it is omitted Remark It should be noted that the inequalities ... independently and randomly from {0, 1} The winner ofthe game is the player whose selected string appears first This problem has been formulated as a game or studied as a classical probabilistic problem...
... differential diagnosis of steroid cell tumors We ruled out the diagnosis of adrenocortical carcinoma and paraganglioma on the basis of immunohistochemical markers Adrenocortical carcinomas are negative ... to EMA, keratin, and chromogranin, whereas the tumor in the present case was positive for these markers An absence of mass lesions in bilateral adrenals further ruled out the diagnosis of adrenocortical ... her pregnancy Conclusions The present case was a rare report of an extraovarian and extra-adrenal steroid cell tumor ofthe pelvic mesentery The tumor was a cause of virilizing symptoms and infertility...
... Java and all Java-based trademarks and logos are trademarks or registered trademarks of Oracle and/or its affiliates Windows and Microsoft are trademarks of Microsoft Corporation in the United States, ... The Content Pane The Border Container and Border Pane Accordion Container and Accordion Pane The Tab Container and the Tab Pane The Stack Container and the Stack Pane Understanding the Tree Node ... integrating relational data and the new relational database components that the ExtLib provides, including JDBC, the Connection Pool and Connection Manager, the datasources, and the Java and Server-Side...
... another main task ofthe department • Financial and Accounting department: this department deals with all financial and accounting matters Another main function is to manage the use of capital ... 5D The Marketing Strategy ofa multinational join stock company if they take care of their customers, market share and profits will follow Creating customer values and satisfaction is at the ... company and distribution of ideas, goods, and services to create exchanges that satisfy individual and organizational goals”2 The writer ofthe book The Silk Road to International Marketing” had...
... headed advertising or advertisement feature (a more official name for the advertorial), and this is meant to alert the reader to the nature ofthe article, although the layout ofthe page often ... of waste gases with water in the air, making the rain acidic In the early 1970s the term was revived as it became clear that acid rain was having a terrible effect on the forests and lakes of ... to the landside, the public area ofthe airport) History and Usage: Theword airside has been in use in the technical vocabulary of civil aviation since at least the fifties, but only really came...
... headed advertising or advertisement feature (a more official name for the advertorial), and this is meant to alert the reader to the nature ofthe article, although the layout ofthe page often ... of waste gases with water in the air, making the rain acidic In the early 1970s the term was revived as it became clear that acid rain was having a terrible effect on the forests and lakes of ... to the landside, the public area ofthe airport) History and Usage: Theword airside has been in use in the technical vocabulary of civil aviation since at least the fifties, but only really came...
... headed advertising or advertisement feature (a more official name for the advertorial), and this is meant to alert the reader to the nature ofthe article, although the layout ofthe page often ... of waste gases with water in the air, making the rain acidic In the early 1970s the term was revived as it became clear that acid rain was having a terrible effect on the forests and lakes of ... to the landside, the public area ofthe airport) History and Usage: Theword airside has been in use in the technical vocabulary of civil aviation since at least the fifties, but only really came...
... Indicates that no action takes place SetDefault Indicates that the DataColumn values in the child DataTable are to be set to the value in the DefaultValue property ofthe DataColumn SetNull Indicates ... to the parent table Updating the Primary Key ofa Parent Table and Pushing the Change to the Database In this section you'll learn what happens if you attempt to update the primary key in a parent ... that the DataColumn values in the child DataTable are to be set to DBNull By default, UpdateRule is set to Cascade; therefore, when you change the DataColumn in the parent DataTable on which the...
... PsativumA SoleraceaA 197 Chlamy 200 Synechocystis 198 Synechococcus 199 R R R R R R R R R R R R R R R R R R R R AAAAAAAAAA R R R R R R R R R R AAAAAAAAAAAAAAAAAAAAA ... T T T T T G G G G G G G G G G AAAAAAAAAAAAAAAAAAAA K K K K K K K K K K AAAAAAAAAA V V V V V V V V V V S S S S AAA S AA L L L L L L L L L L V V V V V V V V V V L ... with NADH and NADPH, but the catalytic rate constant using NADPH was only half that ofthe wild type The catalytic efciency, expressed as kcat/Km, ofthe R197E mutant using NADPH was then about...
... Proceedings of Fifth Annual Meeting ofthe North American Chapter ofthe Association for Computational Linguistics Ravi Sinha and Rada Mihalcea 2007 Unsupervised graph-based word sense disambiguation ... disambiguation In the 12th Conference ofthe European Chapter ofthe ACL Satanjeev Banerjee and Ted Pedersen 2003 Extended gloss overlaps as a measure of semantic relatedness In Proceedings ofthe ... Empirical Methods in Natural Language Processing Weiwei Guo and Mona Diab 2012 Modeling sentences in the latent space In Proceedings ofthe 50th Annual Meeting ofthe Association for Computational...
... unknown polarity They assign any given wordthe label of its synonyms or the opposite label of its antonyms if any of them are known Kanayama and Nasukawa (2006) used syntactic features and context ... Dipak Narayan, Debasri Chakrabarti, Prabhakar Pande, and P Bhattacharyya 2002 An experience in building the indo wordnet - a wordnet for hindi In First International Conference on Global WordNet ... P Farwell D Rodrguez H Pease A Alkhalifa M Elkateb, S 2006 Arabic wordnet and the challenges of arabic In Arabic NLP/MT Conference Ahmed Hassan and Dragomir Radev 2010 Identifying text polarity...
... d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s ... induced simultaneously after inoculation of media with cultures grown to exponential phase in the absence of paraquat and IPTG (Materials and methods [24]) The final concentration of paraquat and IPTG ... prosthetic metal Arch Biochem Biophys 313, 296–303 Yamakura, F., Rardin, R.L., Petsko, G .A. , Ringe, D., Hiraoka, B.Y., Nakayama, K., Fujimura, T., Taka, H & Murayama, K (1998) Inactivation and...
... correlation between the input (data) and output (wisdom) The more data that is created, the more knowledge and wisdom people can obtain IoT dramatically increases the amount of data available ... governments, standards organizations, and academia to work together toward a common goal Next, for IoT to gain acceptance among the general populace, service providers and others must deliver applications ... lead to revolutionary applications that have the potential to dramatically improve the way people live, learn, work, and entertain themselves Already, IoT has made the Internet sensory (temperature,...
... functionality of such a triad is affected by the surrounding residues The results so far indicate that larger parts ofthe polar core ofthe catalytic TIM barrel of family 18 chitinases play a role ... mutant retains considerable activity, whereas the D14 2A mutant does not It has been shown by X-ray crystallography that replacement ofthe Asp142 analogue by alanine in other family 18 chitinases ... environmental factors that are taken into account in the calculations (background charges, desolvation penalty and the interaction with other titratable residues), the first factor was found to be the major...