find the equation of tangent plane to the surface at the point p3 0 4
A STUDY ON THE USE OF PEER TEACHING IN ESP CLASSES AT THE COLLEGE OF SCIENCE, VIETNAM NATIONAL UNIVERSITY HANOI
... 1 10 0 0 8 80 1 10 2 9 90 1 10 8 80 10 100 9 90 3 6 60 9 90 10 100 6 60 8 80 0 0 4 4 40 10 100 9 90 8 80 0 0 5 7 70 2 20 1 10 0 0 6 8 80 1 10 10 100 2 20 7 10 100 7 70 10 100 9 90 ... 10 100 9 90 8 80 8 1 10 0 0 3 30 8 80 3 30 7 70 5 50 10 100 9 8 80 7 70 5 50 8 80 0 0 2 20 10 8 80 10 100 9 90 0 0 0 0 Table 2: Result from the survey questionnaire for the teachers ... 60 9 90 10 100 6 60 8 80 0 0 4 4 40 10 100 9 90 8 80 0 0 Table 4: Teachers’ perceptions of peer teaching Option Item a No % b No % c No % d No % e No % 1 3 3 91 91 0 0 2 92...
- 40
- 903
- 3
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc
... (A˚3) 0. 159 (0. 200 ) 0. 079 (0. 200 )Planar groups (A˚) 0. 015 (0. 0 20) 0. 008 (0. 0 20) B-factors restraintsMain-chain bond (A˚2) 0. 938 (1. 500 ) 0. 838 (1. 500 )Main-chain angle (A˚2) 1.535 (2 .00 0) ... distribution 0. 15 0. 15Chi1–Chi2 distribution 0. 02 0. 02Chi1 only 0. 13 0. 10 Chi3 and Chi4 0. 51 0. 32Omega )0. 46 )0. 43 Average score )0. 05 )0. 06Main-chain covalent forcesMain-chain bond lengths (A˚) 0. 63 ... 0. 077 0. 033 ⁄ 0. 031rAerror estimate (A˚) 0. 04 0. 02Stereochemical restraints r.m.s. (r)Bond distances (A˚) 0. 011 (0. 021) 0. 007 (0. 021)Bond angles (°) 1. 609 (1.965) 1. 2 04 (1.939)Chiral...
- 11
- 548
- 0
IN SEARCH OF SOLUTIONS TO IMPROVING THE ENGLISH LANGUAGE PROFICIENCY FOR UNDER GRADUATE STUDENTS AT THE COLLEGE OF TECHNOLOGY (COT) VIETNAM NATIONAL UNIVERSITY, HANOI
... and stipulates either of the international standardized tests (TOEFL 500 -5 50 or IELTS 5 .0- 5.5) as a means of evaluating the high-quality students' English level at the end of the fifth ... international institutions for tertiary education, and which allows the students to communicate satisfactorily in the integrated working environment later, ranging at least from 500 to 5 50 points ... learners; they include functional skills as well as linguistic objectives. The learner’s role is the negotiator and integrator. The teacher’s role is the facilitator of the communication process. Materials...
- 88
- 675
- 1
Báo cáo khoa học: The involvement of human ribonucleases H1 and H2 in the variation of response of cells to antisense phosphorothioate oligonucleotides pot
... ElectroporationMiaPacaII 40 0 nM 4. 4 0. 0 7.8 2 .0 600 nM6 .4 0. 8 ND 800 nM 10. 4 0. 9 24. 2 1 .0 HEK293 40 0 nM 4. 2 0. 6 ND 600 nM6.8 0. 9 ND 800 nM8.7 0. 4 ND15PC3 40 0 nM3.1 0. 3 ... 5 .4 0. 6 600 nM6.5 0. 3 ND 800 nM9.1 1 .4 13 .4 0. 1588 A. L. M. A. ten Asbroek et al. (Eur. J. Biochem. 269) Ó FEBS 200 2 treatment using liposomal transfection with 800 nM(i.e. 800 ... Neurozintuigen Laboratory, AcademicMedical Center, PO Box22 700 , 100 0 DE Amsterdam, the Netherlands. Fax: + 31 20 56 644 40 , Tel.: + 31 20 5665998,E-mail: f.baas@amc.uva.nlAbbreviations: ODN, oligodeoxynucleotide;...
- 10
- 531
- 0
Bringing the Hidden Giants to the Footlight: the Role of Savings and Retail Banks in Increasing the Level of Access to Financial Services docx
... program was created to help over 700 ,00 0 non-agricultural debtors who owe less than US$ 2, 500 to unconventional lenders. The branches of GSB take part in the negotiations with creditors for partial ... the repayment term ranges from 3 to 5 years before the expiry date of the lease right. As of February 2, 200 5, a total of 2 ,05 4 loans, which amounted to US$ 4. 12 million were extended.People’s ... addition to compiling data, it is important to look into the “quality of access”. The WSBI intends to initiate further research in this field.These results not only demonstrate that savings...
- 4
- 511
- 0
The impact of and responses to HIV/AIDS in the private security and legal services industry in South Africa potx
... (0) 21 701 44 77; Fax: +27 (0) 21 701 7 302 www.oneworldbooks.comDistributed in Europe and the United Kingdom by Eurospan Distribution Services (EDS)Tel: +44 (0) 20 72 40 0856; Fax: +44 (0) 20 ... dept13 .4 9.7 1 .00 9.7Limpopo Municipality 10. 1 6.2 2. 30 14. 3Utility/parastatal National parastatal 6.6 5.6 1.32 7 .4 National utility 8.5 8 .4 1. 60 13 .4 National utility 10. 8 10. 1 1.39 14. 1National ... the two sectors of SASSETA, which necessitated some changes to the sampling design, prolonging the duration of the project by six months. The project was concluded at the end of August 200 7.ObjectivesThe...
- 192
- 478
- 0
Báo cáo y học: " the Value of Serum Biomarkers (Bc1, Bc2, Bc3) in the Diagnosis of Early Breast Cancer"
... Kemal Atahan, 6 342 sok. No :44 Ayşe Kaya 2 Apt. Kat:3, Daire:6 355 40 Bostanlı/İzmir/TURKEY. Phone: + 905 3 241 26 805 ; Fax: + 902 32 244 56 24 ; e-mail: kemalatahan@yahoo.com.tr Received: 201 0.11. 10; Accepted: ... 50mM Tris/HCl, pH 9 .0, 2 % (wv1) CHAPS) at the ratio of 5:1. Sera were then diluted again with binding solution at the ratio of 10: 1 and were applied in 100 µL amounts in the wells on the ... Analysis Pattern and SELDI-TOF-MS to Discriminate Transitional Cell Carcinoma of the Bladder Cancer from Non-cancer Patients. Eur Urol 200 5 ;47 (4) : 45 6 46 2 16. Wilson LL, Tran L, Morton DL, Hoon...
- 8
- 584
- 0
Tài liệu Guidelines for the appointment of General Practitioners with Special Interests in the Delivery of Clinical Services pdf
... counter-signed asappropriate by an Educational mentor or supervisor/s to confirm the satisfactoryfulfilment of the required training experience and the acquisition of the competencies enumerated in this ... strategic direction of local sexual health services inparticular lead implementation of the National Strategy; participate in the monitoring of outcomes and support development of integrated services.ã ... andcontraindications of the full range of contraceptive techniques.Methods for TOP, theirrelative advantages anddisadvantages indicationand contraindications.Understanding of the different...
- 11
- 489
- 0
Tài liệu Báo cáo khoa học: Effect of deletion of the DNase I hypersensitive sites on the transcription of chicken Ig-b gene and on the maintenance of active chromatin state in the Ig-b locus docx
... the negative control, noenhanced acetylation of either histone was demonstrated at the targets located close to the Ig-b promoter andDT 40 - specific DHSs. Acetylation levels of both histones at ... associated with DHSs in the Na channel gene and in the first intron of the Ig-bgene. Furthermore, the acetylation status of H3 andH4 histones was examined [15]. In the present study, 10 DT 40 - specific ... MluI; 2 .4 kb), 16 kb Del-R (+6 703 to +8768; 206 6 bp), I-L () 10. 1 kb to )7.8 kb, BamHI ⁄ XhoI; 2.3 kb),I-R () 600 9 to )3 942 ; 206 8 bp), II-L ( )46 13 to )2692;1922 bp), II-R (+ 50 to +1959; 19 10 bp),...
- 11
- 638
- 0
Báo cáo khoa học: Limited mutagenesis increases the stability of human carboxypeptidase U (TAFIa) and demonstrates the importance of CPU stability over proCPU concentration in down-regulating fibrinolysis doc
... reverse: C-HIS1-rev (atgatgatgcttatcgtcatcgtccccgggctcgagaacattcctaatga catgccaagc) and C-HIS2rev (cggggtaccttattaagatccactatgatgatgatgatgatgatgatgct tatcgtcatcgtcc). The resulting PCR fragment ... and x is the molar concentration of the inhibitor, A is locked to 0% , B to 100 %, C is the IC 50 value and D is the slope of the curve. The IC 50 valueis the concentration x, where y ẳ 50% .Kmwas ... (ggggaccactttgtacaagaaagctgggtcctaagatccactatgatgatgatgatgatgatgatg). The resulting PCR fragments were subcloned into the entry vector pDONR 201 (Invitrogen) using the GatewayTMTechnology with help of a BP reaction...
- 15
- 397
- 0
Hollywood on the Head of a Pin: Montage and Marketing at the Oscars® docx
... relations the collection has to the outside world, particularly to the social and material conditions of mass production.” (Klinger, 147 ) Like the collector, the spectator of the film history montage ... 1 40 - 145 ) and with that of the circus sideshow. Much of the appeal of these montages is the impossible task they attempt: all of film history in four minutes! Like the pre-cinematic appeal of ... staff, seat-savers, and crew, in addition to the virtual presences of the fans pressing at the gates, the reporters lurking in the wings, and the implied global spectators watching the show,...
- 10
- 612
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008