0

each to iterate over the jquery object and provide a reference to each element in the object using the this keyword

Tài liệu ANTHROPOLOGY: AS A SCIENCE AND AS A BRANCH OF UNIVERSITY EDUCATION IN THE UNITED STATES pptx

Tài liệu ANTHROPOLOGY: AS A SCIENCE AND AS A BRANCH OF UNIVERSITY EDUCATION IN THE UNITED STATES pptx

Cao đẳng - Đại học

... of “geographical provinces” or “areas of characterization.” The continental areas at the date of man’s appearance on the earth Eurafrica, Austafrica, Asia, America, Oceanica Causes and consequences ... works Nearly all the individual works in the collection are in the public domain in the United States If an individual work is in the public domain in the United States and you are located in the ... institution for teaching Anthropology must have a Laboratory attached to it; and in that Laboratory the best part of the work will be done Such a Laboratory will naturally be divided into two departments;...
  • 28
  • 665
  • 0
Báo cáo khoa học: Linking environmental carcinogen exposure to TP53 mutations in human tumours using the human TP53 knock-in (Hupki) mouse model doc

Báo cáo khoa học: Linking environmental carcinogen exposure to TP53 mutations in human tumours using the human TP53 knock-in (Hupki) mouse model doc

Báo cáo khoa học

... areas of Serbia, Bosnia, Croatia, Bulgaria and Romania BEN is clinically and morphologically very similar to AAN; indeed, AA-specific DNA adducts have been detected in BEN patients and in individuals ... mutagens and potential human carcinogens identified in diesel exhaust and ambient air pollution [69–71] Indeed, 3-NBA induces squamous cell carcinoma in rat lung after intratracheal administration ... E Kucab et al Investigating human cancer aetiology using the HUF immortalization assay Thus far, four environmental carcinogens have been examined using the HUF immortalization assay: (a) UV...
  • 17
  • 308
  • 0
báo cáo hóa học:

báo cáo hóa học: " Primary glia expressing the G93A-SOD1 mutation present a neuroinflammatory phenotype and provide a cellular system for studies of glial inflammation" potx

Hóa học - Dầu khí

... paracrine inflammatory networks has become increasingly appreciated in recent years In this capacity astrocytes likely respond to neural damage, infection, or tumorigenisis in such a way as to ... Dynamics, Sunnyvale CA) and bands quantified using instrument-resident densitometry software (ImageQuant™, Molecular Dynamics) Within each sample, the density of each apoptosis-associated mRNA ... elicits a fundamental influence upon multiple gene regulatory pathways excitotoxins (eg quinolinic acid) and other paracrine factors that might injure neaby neurons [29] Research ongoing in our laboratory...
  • 9
  • 436
  • 0
báo cáo khoa học:

báo cáo khoa học: " Using intervention mapping to develop and adapt a secondary stroke prevention program in Veterans Health Administration medical centers" ppt

Báo cáo khoa học

... necessarily having the knowledge or training to address the stroke risk factor modification, we provided standard training and education regarding patient motivational interviewing and goal setting ... and services within the VA; better education to the providers regarding risk factors and warning signs; and improved administrative support A summary of the emergent themes is available in Table ... endorsed the idea that they have a role in secondary stroke risk factor management (81% in Indianapolis and 100% in Houston) However, there was a disparity in the extent and delivery manner of this...
  • 11
  • 291
  • 0
báo cáo khoa học:

báo cáo khoa học: " Assessing the contribution of alternative splicing to proteome diversity in Arabidopsis thaliana using proteomics data" docx

Báo cáo khoa học

... under-represented in the Baerenfaller set, and; (ii) AS events were over- represented in both the Castellanaand the Merged set Baerenfaller and Castellana sets Comparison to the same fraction calculated for the ... under-represented in the experimental proteomics datasets, is the most plausible A key factor that might explain the over- representation of AS events in the Castellana set compared to the Baerenfaller set, involves ... confirmed using the latter set (Table 2) Comparison of the AS loci revealed that seven AS loci had confirmed AS events in both the Castellana- and Baerenfaller sets In total, 60 AS events corresponding...
  • 10
  • 244
  • 0
Báo cáo y học:

Báo cáo y học: "Human immunodeficiency virus integrase inhibitors efficiently suppress feline immunodeficiency virus replication in vitro and provide a rationale to redesign antiretroviral treatment for feline AIDS" pdf

Báo cáo khoa học

... IN is similar to that of HIV-1 IN; and it is organized in C- and N- terminal domains, and a catalytic core domain (CCD) The C-terminal domain is likely to be involved in target (i.e., cellular) ... were in Ramachandran-favored position and 5% were in Ramachandran-allowed positions [see Additional file 1] When HIV-1 and FIV IN CCD structures were superimposed, all amino acids facing the catalytic ... http://www.retrovirology.com/content/4/1/79 A increasing aa similarity B C Figure Proposed binding mode of integrase strand transfer inhibitors (INSTIs) to FIV integrase Proposed binding mode of integrase strand transfer inhibitors (INSTIs)...
  • 13
  • 309
  • 0
Tài liệu Bike Lanes, On-Street Parking and Business: A Study of Bloor Street in Toronto’s Annex Neighbourhood docx

Tài liệu Bike Lanes, On-Street Parking and Business: A Study of Bloor Street in Toronto’s Annex Neighbourhood docx

Tài chính doanh nghiệp

... Clair streetcar exclusive right‐of‐way, TPA is building new ‘Green P’ lots to make up for some  of the lost on‐street parking.)   Rather than using observational data, parking capacity and usage data was requested from the Toronto Parking Authority (TPA). Because the TPA now exclusively employs pay and display  ... how much they spend in the area; the purpose of their visit; what form of transportation they  use to get to the area; and their preference for a bike lane or a wider sidewalk. Again,  pedestrians were also asked about widening the sidewalk, as an alternative to installing a bike  ... The spending habits of cyclists and pedestrians, their relatively high travel mode share, and the minimal impact on parking all demonstrate that merchants in this area are unlikely to be  negatively affected by reallocating on‐street parking space to a bike lane. On the contrary, this ...
  • 38
  • 686
  • 0
Tài liệu Báo cáo khoa học: Two novel variants of human medium chain acyl-CoA dehydrogenase (MCAD) K364R, a folding mutation, and R256T, a catalytic-site mutation resulting in a well-folded but totally inactive protein pptx

Tài liệu Báo cáo khoa học: Two novel variants of human medium chain acyl-CoA dehydrogenase (MCAD) K364R, a folding mutation, and R256T, a catalytic-site mutation resulting in a well-folded but totally inactive protein pptx

Báo cáo khoa học

... (5¢-GAT AAAACCACACCTGTAGTAGCTG-3¢) and MCAD 116 5A G (5¢-CCTGTAGAAAGACTAATGAGGGATG CC-3¢) (mutagenic substitutions are shown in bold), and the antisense primer (5¢-GTAACGCCAGGGTTTTCCCA GTCAC-3¢) ... over increasing temperature (A) This shows the thermostability as determined by the ferricenium assay after a 10-min incubation at the temperature indicated (error bars ¼ standard deviation of the ... activity, as the kcat and the ETF interaction are relatively unaffected This mutation seems to affect mainly the initial folding and stability of the tetramer, and similarly lowered levels of tetramer...
  • 9
  • 533
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "A Method for Correcting Errors in Speech Recognition Using the Statistical Features of Character Co-occurrence" pptx

Báo cáo khoa học

... meaning (D) Considerably lacking in meaning (E) Unable to understand, and unable to imagine the actual utterance Results and Discussions 4.1 Decrease in the Number of Errors Table 4-1 shows the ... the Error-Pattem-Database and String-Database can be mechanically prepared, which reduces the effort required to prepare the databases and makes it possible to 657 word-class splitting and consecutive ... extracted from the speech recognition results and the corresponding actual utterances, then they are stored in a database (referred to as an Error-Pattern-Database) In EPC, the correction is made...
  • 5
  • 588
  • 0
Báo cáo y học:

Báo cáo y học: "Notochordal conditioned media from tissue increases proteoglycan accumulation and promotes a healthy nucleus pulposus phenotype in human mesenchymal stem cells" pot

Báo cáo khoa học

... decreases in collagens I, III and X, the catabolic enzymes matrix metalloproteinases (MMPs) and A distintegrin and metalloproteinase with thrombospondin motifs (ADAMTSs) and inflammatory cytokines ... executed the study and helped with data analysis and interpretation including drafting the manuscript All authors read and approved the manuscript Competing interests The authors declare that they have ... growth factor genes, catabolic/anti-catabolic genes and inflammatory/pain genes (Additional file Table S1 and Additional file Table S2) Relative gene expression was calculated using the comparative...
  • 13
  • 349
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " A short-term divergent selection for resistance to Teladorsagia circumcincta in Romanov sheep using natural or artificial challenge" pptx

Báo cáo khoa học

... grazing animals, the pasture in each paddock was sampled on the first and last day of the grazing period and the larvae were extracted and counted [16] At the same time, grass availability was ... cages This estimate gave acceptable data in 1990, but not in 1992, when the estimated feed availability was too high The dead material in the pasture in 1992 was not taken into account, leading ... (generation G2) In 1992, half of the lambs from each group were challenged in the same way as their sires, and the other half was tested using the alternative challenge Mating was intended to produce...
  • 26
  • 231
  • 0
Báo cáo y học:

Báo cáo y học: "Use of chinese and western over-the-counter medications in Hong Kong"

Y học thưởng thức

... inter-professional communication and access to patients’ medical information are essential to integrate pharmacists in the primary care system [20] The role of medical professionals is a dominant factor in ... in defining, controlling and scoping the work of the allied health professionals [21,22] as extending pharmacists’ role in primary care may affect the autonomy and control of the medical professionals ... (SPSS Inc., Chicago, IL, USA), separately for western and Chinese medicine Our data analysis Analysis of THS data were conducted without imputation of missing data We focused our multivariate data...
  • 9
  • 516
  • 0
Music cover, the effects of it and The attitudes of NEU’s students to Music cover in Vietnam

Music cover, the effects of it and The attitudes of NEU’s students to Music cover in Vietnam

Khoa học xã hội

... research the topic, used both primary data and secondary data: - Finding documents in the Internet and magazine Overview previous researches which have the same topic Surveying in 100 students in ... audience has the most difficult standard with music, many kinds of music stream are increased, music cover is a typical example Rationale: Nowadays, finding covered songs are so easy, they appear in ... Literature review and Data analysis and discussion In Literature review, the report reviews on previous studies and shows what the achieved points and the weakness in each study are After that,...
  • 23
  • 567
  • 0
TEACHING PRONUNCIATION TO THE FIRST YEAR STUDENTS AT THE UNIVERSITY OF TRANSPORT AND COMMUNICATIONS a CASE STUDY

TEACHING PRONUNCIATION TO THE FIRST YEAR STUDENTS AT THE UNIVERSITY OF TRANSPORT AND COMMUNICATIONS a CASE STUDY

Khoa học xã hội

... beliefs and knowledge, formal curricula, teaching goal and assessment, teacher’s roles, teacher’s approaches and techniques, teaching and learning materials All the examined aspects were analyzed in ... was not the central focus in their teaching They were all in a rush to the students’ final examination in which pronunciation took an unimportant part The materials for learning and teaching pronunciation ... games that are out of central teaching objectives’ (Hang, aged 40) The teachers developed a wealth of resources for other teaching areas such as grammar and vocabulary They felt that an equally...
  • 40
  • 984
  • 4
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

Báo cáo khoa học

... CTTTGTTATTTATTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAATAAATAACAAAG CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAAGCTTTAACAAAG CCTCTTACACTTGCTTTTGAC GCAAAGGTGCCTTTGAGGTTG GACCCCTTCATTGACCTCAACTA ... TACGAGATCTGTTGTTTGGAAGCAGGTT CGGAAGATCTGGGATCATGCCCATTTAG TACGAGATCTTAGCTACATTAAATAGGC GGGATCATGCCCAAGCTTATTTTCCTTACT AGTAAGGAAAATAAGCTTGGGCATGATCCC GCTCACTGCCTAAGCTTTGTAGCTAATAAAG CTTTATTAGCTACAAAGCTTAGGCAGTGAGC ... domain either 5¢ or 3¢ to the core domain resulted in a similar deadenylation and overall mRNA decay rate [33] The PAI-2 ARE is unusual in that in addition to an auxiliary domain (Fig 7, the atypical...
  • 14
  • 635
  • 0
Tài liệu The Little Guide To Beating Procrastination, Perfectionism and Blocks: A Manual for Artists, Activists, Entrepreneurs, Academics and Other Ambitious Dreamers docx

Tài liệu The Little Guide To Beating Procrastination, Perfectionism and Blocks: A Manual for Artists, Activists, Entrepreneurs, Academics and Other Ambitious Dreamers docx

Quản trị kinh doanh

... the club manager must think I’m a jerk, too. I’m sure he’ll never let me perform  there again. I feel like crap. I just can’t stand it. I’m going to get a quart of ice­ cream and rent a bad movie and crawl into bed.” And here’s the other: “Darn! This is so disappointing. I guess I screwed up by not promoting the gig  ... are the activities we turn to when we are afraid, and they serve to distract us from both  the fear, and the guilty knowledge that we are procrastinating. Procrastination has, in fact,  an amazing ability to disguise itself: that is one of its most powerful weapons. What ... “starving” seems like such fun ­ and the artists in these kinds of works always seem to find someone to cadge a good meal off of, anyway ­ and then, to top it off, the artist  frequently later hits the jackpot and achieves professional success.  ...
  • 87
  • 610
  • 0
Tài liệu ‘Unheard voices’: listening to Refugees and Asylum seekers in the planning and delivery of mental health service provision in London. pptx

Tài liệu ‘Unheard voices’: listening to Refugees and Asylum seekers in the planning and delivery of mental health service provision in London. pptx

Kỹ năng nghe tiếng Anh

... maintained A big thank you to Deborah Haylett and Finn, Ermias Alemu, Sasha Rozansky and Mahi Salih and Ben Gatty of Islington Metamporhis and Paul Burns of Mind in Harrow for advice, support and so ... based services stated that there wasn’t enough support from the NHS and that they couldn’t provide training to staff or pay them a reasonable wage ‘We can’t cope with demand and are having to ... Improving the asylum processes to make them faster and fairer, and working more with destitute asylum seekers by providing them with accommodation and at the very least basic living standards and access...
  • 92
  • 1,134
  • 0
The Sun to the Earth -- and Beyond: A Decadal Research Strategy in Solar and Space Physics potx

The Sun to the Earth -- and Beyond: A Decadal Research Strategy in Solar and Space Physics potx

Vật lý

... undergraduate and graduate), to teach solar and space physics graduate programs, and to integrate topics in solar and space physics into basic physics and astronomy classes Recommendation: The NSF and ... Recommendation: In collaboration with other interested agencies, the NSF and NASA should take the lead in initiating a program in laboratory plasma science that can provide new understanding of fundamental ... of the data for operational use.4 Recommendation: NASA and NOAA should initiate the necessary planning to transition solar and geospace imaging instrumentation into operational programs for the...
  • 197
  • 508
  • 0
Bank income and profits over the business and interest rate cycle pdf

Bank income and profits over the business and interest rate cycle pdf

Ngân hàng - Tín dụng

... were almost perfectly collinear (the shares of other assets in total assets were constant) Instead, we use the share of cash and central bank balances in total assets The share of loans in the banks’ ... foreign assets are separated) as well as the balance sheet total On the assets side, it can be seen that the shares of cash and central bank balances, interbank claims and loans (despite rising loans ... Openness and the share of non-interest income in total income Openness (the share of the sum of foreign assets and liabilities in the balance sheet total) and the ratio of non-interest income to total...
  • 44
  • 402
  • 0
Long-term Exposure to Traffic-related Air Pollution and Type 2 Diabetes Prevalence in a Cross-sectional Screening-study in the Netherlands pdf

Long-term Exposure to Traffic-related Air Pollution and Type 2 Diabetes Prevalence in a Cross-sectional Screening-study in the Netherlands pdf

Điện - Điện tử

... authorities in the study area and were linked to a digital map of all roads in the Netherlands (NWB), using GIS Other land use data were obtained from a European land use database (CORINE) Supervised ... within range of the original database [20] Correlation between modeled NO -concentration and distance to the nearest main road was high (Spearman’s r: -0.88) Distance to the nearest main road and ... towns or villages within these municipalities, the highways (provincial roads) adjacent to the area and the nearest freeway, which is located to the west of the study area The circle within the...
  • 9
  • 771
  • 0

Xem thêm