does eradication of helicobacter pylori decreases the expression of p53 and c myc oncogenes in t
Báo cáo khoa học: In vivo studies of altered expression patterns of p53 and proliferative control genes in chronic vitamin A deficiency and hypervitaminosis pot
... using the primers 5¢-TGTAACCTCTACTCCCA CCCA-3¢ (forward) and 5¢-TCTGAGTCCTTATCCAGC CTG-3¢ (reverse) corresponding to a region of the c- Jun promoter that expands between the start transcription ... 5¢-GTCGTCCAGATACTCAGCAT-3¢ (reverse) and primers for cyclin D1: 5¢-TGTTCGTGGC CTCTAAGATGA-3¢ (forward) and 5¢-GCTTGACTCCA GAAGGGCTT-3¢ (reverse); primers for 18S rRNA: 5¢-GAGTATGGTCGCAAGGCTGAA-3¢ ... target, the cyclin-dependent kinase inhibitor p21WAF1/CIF1, suggesting that one particular function of c- Jun is the negative regulation of p53 transcription The fact that the binding of RAR to...
- 9
- 508
- 0
Báo cáo khoa học: Dual expression of mouse and rat VRL-1 in the dorsal root ganglion derived cell line F-11 and biochemical analysis of VRL-1 after heterologous expression pptx
... to introduce the codon for P761 and a stop codon to prevent GFP expression: mutVRL-1_F (5¢-TCAGGTCCTCCAG TCCCCCTAAGGGCAATTCTGCAGAT-3¢) and mutVRL-1_R (5¢-ATCTGCAGAATTGCCCTTAGGGGGA CTGGAGGACCTGA-3¢) ... obtain fragment C with 836 bp; rVRL-1–1618F: 5¢-TTCCTGCTGGTCTACCTG GT-3¢ and rVRL-1–2251R: 5¢-CTTCCTCTGAGGCACT GTTC-3¢ to obtain fragment D with 633 bp All primers were purchased from MWG Biotech ... cells PCR primers were designed according to the rat VRL-1 sequence (Acc No AF129113) rVRL-1–34F: 5¢-CTGGAGACTTCCGATGGAGA-3¢ and rVRL-1–568R: 5¢-CATCCGCTCCATTCTCTACC-3¢ to obtain fragment A with...
- 8
- 439
- 0
báo cáo khoa học: "The expression and role of protein kinase C (PKC) epsilon in clear cell renal cell carcinoma" ppt
... suggesting that PKCε may contribute to the resistance of clear cell RCC cells to cytotoxic drugs Figure Changes of caspase-3 activity in 769P cells after PKCε downregulated and cytotoxic drug treatment ... 5’-ATGGTAGTGTTCAATGGCCTTCT-3’; reverse, 5’-TCAGGGCATCAGGTCTTCAC-3’ The sequences of internal control glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were as follows: forward, 5’-ATGTCGTGGAGTCTA ... and chemosensitivity of RCC Conclusions Our results confirm the role of PKCε as an oncogene in RCC, especially in the subtype of clear cell, suggesting that PKCε might be a potential treatment target...
- 9
- 308
- 0
Bóa cáo y học: " Helicobacter pylori infection is not associated with an increased hemorrhagic risk in patients in the intensive care unit" potx
... was positive if the ratio between the optical density of the specimen and the mean optical density of the control was or more Clinical data The following clinical characteristics were recorded: ... control window and a pink line in the test window, and negative if there was a blue line in the control window and no pink line in the test window Serological study Two of the 12 centers also tested ... to the sample port of the test cassette The test was read after incubation for exactly minutes at ambient room temperature Tests were recorded as positive if there was a blue line in the control...
- 6
- 240
- 0
Distinct histone deacetylases repress expression of LH and FSH beta genes in the immature gonadotrope alphat3 1 cells and the repression is reversed by GNRH
... GATCCCCCCCATAGAATCAAAGCACCTTCAAGAGAGGTGCTTTGATTCTATGGGTTTTTA GGGGGGTATCTTAGTTTCGTGGAAGTTCTCTCCACGAAACTAAGATACCCAAAAATTCGA SMRT-B GeneID 20602 GATCCCCTGACTACATCACCTCGCAGTTCAAGAGACTGCGAGGTGATGTAGTCATTTTTA AGCTTAAAAATGACTACATCACCTCGCAGTCTCTTGAACTGCGAGGTGATGTAGTCAGGG ... GATCCCCAGGAAGAGTGTTCCTGATTTTCAAGAGAAATCAGGAACACTCTTCCTTTTTTA AGCTTAAAAAAGGAAGAGTGTTCCTGATTTCTCTTGAAAATCAGGAACACTCTTCCTGGG SMRT-A GeneID 20602 GATCCCCCCCATAGAATCAAAGCACCTTCAAGAGAGGTGCTTTGATTCTATGGGTTTTTA ... β-actin gene I β-actin gene II Sequence (5’-3’) GCCTGTCAACGCAACTCTGG CAGGCCATTGGTTGAGTCCT AGCACTGACTGCACCGTGAG CCTCAGCCAGCTTCATCAGC GCCATGTACGTAGCCATCCA Primer size (bp) 20 20 20 20 20 20 Amplicon...
- 94
- 284
- 0
Regulation of navigation and vessel-source pollution in the Northern Sea Route - Article 234 and state practice
... Harmonisation Conferences, where the coast guards and maritime directorates of the Arctic littoral states and other interested states also took part.131 As to the Arctic Council, among its objectives is the ... Areas of the Far North and Marine Areas Adjacent to the Northern Coast of the USSR22 (Environmental Edict) in its Article specified: In the marine areas adjacent to the northern coast of the USSR ... the ice-covered exclusive economic zones in the Arctic The aim is to demonstrate how the state practice, including legislation, of relevant Arctic states has been shaping the contours of Article...
- 23
- 555
- 0
Tài liệu Impact Evaluation Of Small And Medium Enterprise Programs In Latin America And The Caribbean pptx
... International Financial Institution IFI International Monetary Fund IMF Instituto Nacional de Estadistica (National Statistical Institute) INE Instituto Nacional de Estadistica e Informatica INEI ... set of pre-treatment attributes In this formulation, the program indicator D is assumed to be independent of the potential outcomes conditional on the attributes used to select the treatment ... probability of exit The country studies tested for this potential source of bias by re-estimating outcome models dropping the bottom and 10 percent of the treatment group that might have failed in the...
- 142
- 662
- 1
Tài liệu Báo cáo khoa học: Comparative studies on the functional roles of N- and C-terminal regions of molluskan and vertebrate troponin-I pdf
... (5¢-CTTGATTTGGATCCTTTAAGGTA TAGC-3¢), ATnI1F and ATnI128R (5¢-GTTCCGGATC CTATCTTCTGGCTTCC-3¢), ATnI130F (5¢-GCCAGAA CCATGGCGGAGGAAC-3¢) and ATnI292R, ATnI130F and ATnI252R (5¢-CAAGTTTGGGATCCTATTTGTTAA CTTTTC-3¢), and ... corresponding interaction in rabbit TnI–TnC in the absence of divalent cation Therefore, this interaction potentially participates in both the Ca2+-dependent activation of the contraction and the maintenance ... resulting in the release of the inhibition and muscle contraction [17] The structural TnC-binding site interacts with the C- domain of TnC in both the relaxed and contractile states, which plays...
- 12
- 514
- 0
Assessing the hazard of metals and inorganic metal substances in aquatic and terrestrial systems
... hazard; rather, the overall hazard of the substance will be determined by toxicity thresholds based on direct toxicity to aquatic life On the other hand, if the predicted tissue concentration in the ... stage to define a speci c UWM and expect that it will stand the test of time Rather, we suggest a general structure of a model in the full expectation that it will change in the light of experience ... BACKGROUND The approach of characterizing the potential hazard of organic chemicals by considering those inherent, chemical-speci c properties that relate to their potential persistence, bioaccumulation,...
- 176
- 401
- 0
Báo cáo khoa học: Deadenylation of interferon-b mRNA is mediated by both the AU-rich element in the 3¢-untranslated region and an instability sequence in the coding region pot
... transfected with these constructs Whereas cells transfected with the construct lacking the hairpin produced detectable amounts of HA-tagged IFN-b, no translation product was detectable with the construct ... Moreover, the transcriptional blockade by actinomycin D abrogated the increase of mRNA accumulation due to the cycloheximide (Fig 1E) This latter observation indicates that increased accumulation of ... transfected into Hec-1B cells The cells were infected (or not) with the Sendaı¨ virus for h and actinomycin D (5 lgÆmL)1) was added in the culture medium Total RNA was extracted at the indicated times...
- 8
- 361
- 0
A Theoretical and Empirical Assessment of the Bank Lending Channel and Loan Market Disequilibrium in Poland doc
... probably strengthen the liquidity constraint of rms, thus increasing their short-term credit demand Putting all these arguments together, the theoretical sign of the parameter of industrial production, ... b and y standing for the loan interest rate, the bond interest rate and the income elasticities of loan demand respectively, y the real output and p the price of output The positive dependance ... central bank as operating on interest rates rather than controlling the base money The interest rate control assumption reects the actual conduct of monetary policy in Poland since 1994 According...
- 36
- 473
- 0
Testing Costs and Testing Capacity According to the REACH Requirements – Results of a Survey of Independent and Corporate GLP Laboratories in the EU and Switzerland potx
... charge to their internal and external customers Thus, this price comprises more than the actual or standard costs of a test It includes all costs associated with the carrying out of a test, including ... influencing the distribution Among others these are the properties of the substances to be tested, unexpected events during the tests, and intermediate results; because they often determine the effort and ... of tests they conducted in the past one or two years The critical question certainly concerns the average capacity since this knowledge is needed to determine the number of studies the labs could...
- 19
- 493
- 1
A BRIEF HISTORY OF PANICS AND THEIR PERIODICAL OCCURRENCE IN THE UNITED STATES pdf
... panic, and this I believe to be true in the case of other countries Why is this? Is it not because the people instinctively turn to tinkering at and changing their chief tax the tariff whenever they ... note attached to this Introduction, a new tariff or a general change of duties is apt to precipitate a panic, on account of the unsettling of business, and that the consequent shaking of credit adds ... products, and to lower the price of all that the farmer has to buy But the farmers vote as the manufacturers and other active classes of the minority of our voters may influence; and only twice in...
- 172
- 499
- 0
Báo cáo khoa học: Expression and functional characterization of P2Y1 and P2Y12 nucleotide receptors in long-term serum-deprived glioma C6 cells ppt
... differentiation of the cells into astrocytes or oligodendrocytes, but are connected with the lack of serum in the culture medium Furthermore, these data indicate that growth arrest and GFAP expression ... medium Taken together, the data presented here indicate that the P2Y12 receptor acts in favor of cell growth and proliferation because of (a) the reduction in cAMP concentration, (b) the stimulation ... extracellular concentration of ATP should first in uence the P2Y2 receptor, and furthermore its metabolite should in uence the P2Y12 receptor as strongly as P2Y1 We know that the concentration of the...
- 13
- 378
- 0
a history of light and colour measurement, science in the shadows - johnston
... varies inversely as the square of the distance and directly as the illumination of the writing; then the amount of light lost at the greatest obscuration of the sun was 2/5ths that of the unobscured ... complementary way to that of the reflected component as the crystal was rotated Assuming the total intensity to be conserved, he deduced that the reflected component was proportional to the cosine of the ... measurement of light and colour from its first hesitant emergence to its gradual construction as a scienti c subject The first traces changing attitudes concerning quantification The mathematization of...
- 292
- 439
- 0
the mit ress vision and mind selected readings in the philosophy of perception sep 2002
... guides to the character of the things that hurt us Particular kinds of smells, on the other hand, are in general characteristic of this or that type of object These considerations I hope constitute ... experience Analytical reection puts forward, instead of the absolute existence of the object, the thought of an absolute object, and, through trying to dominate the object and think of it from no point ... thought In other words, the beliefs and expectations of the perceiver are thought to have no inuence on the character of Introduction the subpersonal computations that constitute perception Thus,...
- 638
- 2,611
- 0
Báo cáo hóa học: " Health-related quality of life of child and adolescent retinoblastoma survivors in the Netherlands" ppt
... of the participating centers and was conducted according to the principles of the Helsinki declaration http://www.hqlo.com/content/5/1/65 We consulted the Dutch national RB register [11] to collect ... research, collected and analyzed the data and drafted the manuscript SMI, ACM and JH participated in the design of the study, interpreted the data and revised the manuscript AYNSM, PJR and PTCK interpreted ... Health Organization MD Mean Differences PTG Post Traumatic Growth Competing interests The author(s) declare that they have no competing interests Authors' contributions JvD has coordinated the...
- 8
- 385
- 0
Báo cáo hóa học: " The effects of diabetes and/or peripheral neuropathy in detecting short postural perturbations in mature adults" pptx
... in data acquisition, subject recruitment and drafting the manuscript All authors read and approved the final manuscript Competing interests The authors declare that they have no competing interests ... with diabetes may not be able to detect small perturbations of the surface on which they stand or that it takes a longer movement distance before they detect the onset of a slip Both actions could ... efficient and provides information not only of the main effects of the factors but also of their combined interactions Since we have unequal sample sizes, to satisfy the orthogonality of the...
- 10
- 594
- 0
Báo cáo hóa học: " Comparison of p53 and the PDZ domain containing protein MAGI-3 regulation by the E6 protein from high-risk human papillomaviruses" pdf
... (5') and EcoRI (3') restriction sites The upstream primer sequence was 5'CAGATCTCATGTTTCAAGACACTGAGGAAAAACCAC while the downstream primer sequence was 5'CAGAATTCGTCACAGTGCAGTTTCT-CTACGTCGG The ... 3, C to T T to G A to C C to A C to T A to C G to T A to C A to C A to T C to T C to T A to V L to R K to N P to T F to F (none) I to L V to L N to H K to N R to R (none) A to V S to S (none) Codon ... the technical direction of MT, LB, and GM who also participated in the design of the study, data analysis and writing the manuscript, FC provided the information contained in Table and direction...
- 9
- 383
- 0
báo cáo hóa học:" Health-related quality of life of child and adolescent retinoblastoma survivors in the Netherlands" doc
... of the participating centers and was conducted according to the principles of the Helsinki declaration http://www.hqlo.com/content/5/1/65 We consulted the Dutch national RB register [11] to collect ... research, collected and analyzed the data and drafted the manuscript SMI, ACM and JH participated in the design of the study, interpreted the data and revised the manuscript AYNSM, PJR and PTCK interpreted ... Health Organization MD Mean Differences PTG Post Traumatic Growth Competing interests The author(s) declare that they have no competing interests Authors' contributions JvD has coordinated the...
- 8
- 254
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25