display 6 1 a structure definition 1 of 3
Tài liệu Báo cáo khoa học: Mixed lineage leukemia: a structure–function perspective of the MLL1 protein ppt
... Tetrahymena Proc Natl Acad Sci USA 96, 14 967 14 972 11 Rasio D, Schichman SA, Negrini M, Canaani E & Croce CM (19 96) Complete exon structure of the ALL1 gene Cancer Res 56, 1 766 1 769 12 Nakamura ... activation [ 31 ] Domain mapping experiments localize B C MLL1-TAD domain E 665 E 666 K2 91 E 666 R294 1 DNA Binding Surface Extended loop MLL1 CXXC domain K2 91 3 E 665 C-Myb 3 α2 R294 α2 1 C-Myb ... role of WDR5 in binding histone H3, at least while WDR5 is incorporated into the MLL1 core Cleavage site BD FYRN TAD FYRC Win SET 1- -3 969 Win motif V3 768 A3 766 90° E3 767 G3 762 S3 7 63 R3 765 L3770...
- 11
- 761
- 0
Báo cáo khoa học: Structure–activity relationships of fowlicidin-1, a cathelicidin antimicrobial peptide in chicken docx
... VWPLVIRTVIAGYNLYRAIKKK RVKRVWPLVIRTVIALYNLYRAIKKK RVKRVWKLVIRLVKALYKLYRAIKKK +8 +4 +5 +5 +5 +8 +11 26 15 23 19 22 26 26 31 4 1.9 18 07 .3 2758.4 2220.8 260 3. 2 31 9 9.0 32 71. 2 31 4 1 .6 18 07 .6 2757.2 2220.9 260 0 .3 ... Fowl -1 (1 23) Fowl -1 (8– 26) Fowl -1 (5– 26) Fowl -1- L 16 Fowl -1- KLKLK 0.5 13 .8 1. 1 2.8 0 .6 2.0 1. 9 2.0 13 .8 2 .3 5 .6 2.4 3. 9 > 7 .6 2.0 3. 5 2 .3 2.8 2.4 2.0 1. 9 4.0 6. 9 4.5 5 .6 4.8 7.8 > 7 .6 > 4 43 38 > 36 0 ... Energies (kcalÆmol )1) Overall 31 . 76 ± 1. 24 Bonds 1. 46 ± 0 .12 Angles 18 . 61 ± 0 .39 Improper 1. 09 ± 0 . 13 van der Waals 5 .30 ± 0. 96 NOE 5 .30 ± 0 . 63 ˚ Pairwise RMSDs for residues 1 26 (A) Backbone 2.98...
- 13
- 386
- 0
Báo cáo khoa học: Molecular basis for substrate recognition and drug ˚ resistance from 1.1 to 1.6 A resolution crystal structures of HIV-1 protease mutants with substrate analogs pptx
... 46. 61 50 1. 10 95 31 8 10 .2 (37 .7) 10 .4 (2 .1) 10 1. 10 0 . 13 0 .17 2 06 57.80 85.59 46. 46 50 1. 30 55 009 7.9 (33 .0) 14 .4 (3. 2) 10 1. 30 0 .12 0. 16 2 23. 5 59.45 87.00 46. 32 50 1 .60 32 005 9 .1 ( 41. 3) 13 .2 ... 0. 033 0. 0 13 0. 030 0.009 0.029 0. 011 0.0 31 0. 010 0. 030 0. 012 0. 034 15 .9 21. 9 27.5 31 . 5 8.0 12 .2 14 .0 23. 7 9.0 13 .7 10 .6 24.4 10 .6 15 .4 14 .7 25.8 22.4 27 .6 29.9 37 .9 16 . 7 21. 1 19 .1 30 .9 14 .2 18 .4 18 .3 ... 13 .2 (3. 7) 10 1 .60 0 .15 0. 23 15 5 58.88 86. 27 46. 40 50 1. 42 40 847 9.8 (70.8) 17 .1 (2 .6) 10 1. 42 0 .18 0. 23 19 9 58. 91 86. 07 46. 54 50 1. 38 47 418 10 .4 (28 .6) 14 .1 ( 13 .8) 10 1. 38 0. 16 0. 21 190 58.46...
- 13
- 302
- 0
The gulf of mexico oil spill a corpus based study of metaphors in british and american media discourse 6 1
... Substances and Materials: Liquid_“Oil” Broadsheet Metaphor Types Metaphor Tokens NYT 51 110 WP 55 12 8 G 82 16 8 TT 60 13 0 Thus, an adaptation of Grady, Taub & Morgan’s (19 96, p .18 1 -18 7) notion of ... its more incendiary stance in general 6. 2.2 .3 A comparative metaphorical representation: BP Table 6. 4 An aggregate comparison of Analogy-Based Metaphors in British and American Broadsheets (NYT, ... metaphorical evaluative threads involving the use of a series of landmark disasters (ranging from Hurricane Katrina, 9 /11 to other significant nuclear, man-made or large-scale natural disasters)...
- 35
- 260
- 0
NGHIÊN CỨU ẢNH HƯỞNG CỦA PHÂN BÓN NPK (3-6-1) ĐẾN SINH TRƯỞNG CỦA LÁT HOA (Chukrasia tabularis A.Juss) GIAI ĐOẠN 1 - 3 THÁNG TUỔI TẠI VƯỜN ƯƠM CƠ SỞ 3 TRƯỜNG ĐẠI HỌC HỒNG ĐỨC
... 40.75 37 .75 37 .75 37 .75 37 .75 χ n tính toán 0.0 217 39 2 . 63 0 435 4.8 9 13 04 15 .847 83 2.09 969 3 0.07 515 3 5 .33 8957 1. 289877 2.02 81 46 1. 39 238 4 13 .11 424 11 .40 5 63 60 . 13 538 χ2n tra bảng 12 .6 Qua bảng (3 .15 ) ... 2 010 8,4 8 .6 73 15 ,1 3, 9 7,5 26, 1 45 ,6 16 , 7 85,9 44,7 97,2 34 ,5 31 , 7 18 8,4 10 9,7 79,8 11 1 ,6 272,7 248 ,3 14 5,2 15 7 ,6 688,7 34 9 ,6 502,8 34 7 ,6 34 8 232 ,9 4 71, 9 1 06, 6 16 , 6 10 ,6 18 ,6 8,9 53 ,1 Nhiệt độ ... 06- 07/05/2 011 H D L 49 17 3 ,66 2 1, 27 2,459 31 51 7,45 1, 78 7,08 29 40 11 49 12 3, 5 83 1, 3 26 2,7 93 45 41 8,74 2,02 8,45 45 39 46 3, 76 1, 37 3 ,1 06 60 25 9,72 2, 23 9, 86 60 26 52 20 3, 049 1, 512 1, 8 63 ...
- 56
- 2,043
- 5
E 6 unit6 a 1 a 2
... Unit PLACES Grade Lesson 1: A1 + A2 Lucky numbers: Task 2: Read the following sentences about Thuy and her house Predict the statement is true (T) or false (F) 1) Thuy is twenty years old ... old 2) She has two brothers 3) They live in a house 4) Their house is in the country 5) Their house is near a school Task 3: Read the passage silently, then answer the questions a) How old is ... questions a) How old is Thuy? b) What does she do? c) What’s her brother’s name? d) How old is he? e) Where does Thuy live? f) What’s there, near the house? 12 near? student Thuy brother ...
- 18
- 314
- 0
Tài liệu Activity 6.1: Risks of Skipping Physical Design ppt
... 40 Activity 6. 1: Risks of Skipping Physical Design Exercise 1: Identifying Potential Risks of Not Doing Physical Design ! Identify the risks of skipping the physical design Consider ... benefits that physical design brings to the design process As a class, discuss the possible risks involved in not completing a physical design The instructor will write your answers on a flip chart...
- 2
- 331
- 0
Tài liệu LUYỆN ĐỌC TIẾNG ANH QUA TÁC PHẨM VĂN HỌC-THE ADVENTURES OF SHERLOCK HOMES -ARTHUR CONAN DOYLE 6-1 pptx
... good husband, a very affectionate father, and a man who is popular with all who know him I may add that his whole debts at the present moment, as far as we have been able to ascertain amount to ... shoulders, and lit up his pipe with the air of a man who has satisfied himself that he is acting for the best "You have a grand gift of silence, Watson," said he "It makes you quite invaluable as a companion ... was their denial that the inspector was staggered, and had almost come to believe that Mrs St Clair had been deluded when, with a cry, she sprang at a small deal box which lay upon the table and...
- 13
- 418
- 0
Tài liệu Báo cáo khoa học: 1,5-Diamino-2-pentyne is both a substrate and inactivator of plant copper amine oxidases ppt
... (fragmentation: m/z 31 7 .3, 30 5.2, 2 91. 1, 2 53. 2 and 240 .1) , 35 0.2 (fragmentation: m/z 33 3.2 and 30 7 .1) and 4 31 . 3 (fragmentation: m/z 414 .3, 38 8 .3 and 33 7 .1) MALDI-TOF-MS of the separated peak ... Commun 31 , 2 16 7 – 217 4 [in German] 24 Naik, B.I., Goswami, R.G & Srivastava, K (19 81) A rapid and sensitive assay of amine oxidase Anal Biochem 11 1, 1 46 14 8 25 Kovacs, N (19 28) Eine vereinfachte ... fragmentation of the parent ion belonging to the DAPY oxidation product (m/z 17 8 .1) fragmentation peaks were observed with m/z 16 1 .1, 14 9 .1, 14 4 .1, 13 5 .1, 13 2 .1, 12 0 .1, 10 9 .1, 95.0 and 82.0 After...
- 13
- 604
- 0
Tài liệu Improving Fourth Grade Students’ Writing Skills With 6+1 Traits of Writing and Writer’s Workshop ppt
... 14 14 14 14 15 RESULTS OF DATA ANALYSIS 20 CONCLUSIONS 25 FUTURE PLANS 26 REFERENCES 28 APPENDIX A 30 APPENDIX B 33 APPENDIX C 36 APPENDIX D 37 APPENDIX E 38 APPENDIX F 39 APPENDIX G 40 Abstract ... Fluency, and Originality To clarify the meaning of creativity, students were directed to add details to partial drawings on the blackboard that lacked detail: a drawing of a person wearing a skirt and ... student (Adams, 19 96, p 20) 6+ 1 Traits of Writing 6+ 1 Traits of Writing “is a vocabulary teachers use to describe their vision of what good writing looks like” (Culham, 20 03, p 7) It is also a model...
- 41
- 638
- 0
Báo cáo khoa học: A Caenorhabditis elegans model of orotic aciduria reveals enlarged lysosome-related organelles in embryos lacking umps-1 function potx
... 53 36 54 26 28 0 0 12 5 68 10 0 96 10 0 75 0 0 0 0 0 0 0 16 0 > 2000 73 50 30 227 58 32 52 53 0 0 43 31 0 57 81 63 36 0 10 0 0 43 0 0 0 0 27 0 19 17 0 0 59 22 54 90 10 4 51 42 73 31 40 31 69 0 20 30 ... P399 5¢-AGCTT GCATGCCTGCAGGTCGACT -3 and P 266 5¢-AAGG GCCCGTACGGCCGACTAGTAGG -3 The two PCR products were fused using P 617 5¢-CAGTGTCCTATA ATTTAAACGCGACTG -3 and P 267 5¢-GGAAACAGT TATGTTTGGTATATTGGG -3 ... P 568 5¢-ATGGTCTCAAAGGGTGAAGAAGA TAAC -3 and P570 5¢-GGATTCTAGACTAGTTTTCCTT CCTCC -3 The cpr -6 and mCherry PCR products were fused using P 612 5¢-TGGACCGTTCTCAGAAAGTAA CTCCGC -3 and P598 5¢-TTTATGTTTTCTTTTAAAC...
- 20
- 440
- 0
Báo cáo khoa học: NMR solution structure and function of the C-terminal domain of eukaryotic class 1 polypeptide chain release factor pdf
... minidomain are loops 33 5 33 9 and 35 7– 36 7 An accurate analysis of 15 N-relaxation measurements of residues 33 5 33 9 was not possible, owing to the overlapping of peaks in the 15 N,1H-correlation spectra, ... Stansfield I (2000) Terminating eukaryote translation: FEBS Journal 277 (2 010 ) 2 61 1 262 7 ª 2 010 The Authors Journal compilation ª 2 010 FEBS A B Mantsyzov et al 10 11 12 13 14 15 16 17 domain of ... antiparallel strands (1, and 7) and strand 6, which is parallel to strand b-Strands are located between the four a- helices (a1 , 278–294; a2 , 30 5– 31 3 ; a4 , 37 4 3 81; and a5 , 39 7–405), with two of...
- 17
- 490
- 0
Báo cáo khoa học: SAF-3, a novel splice variant of the SAF-1/MAZ/Pur-1 family, is expressed during inflammation pptx
... ATCTTCCAGgtaacaac 62 5 cacctcagGGTCACGCC 1C 87 CCATTCCAGgtgagtag 84 ctccgcagGCCGCGCCG 8 51 CTTCTCCCGgtgtgcac 4 03 gtccccagGCCGGATCA 64 AATGTGAGgtaggaag 277 ctcctcagAAATGTGAG 17 2 CAACAAAGgtacatgc 13 35 ... 95, 10 82 10 90 Ray A, Shakya A & Ray BK (2005) Inflammationresponsive transcription factors SAF -1 and c-Jun/c-Fos promote canine MMP -1 gene expression Biochim Biophys Acta 17 32 , 53 61 10 Ray A, Bal ... Biochemistry 36 , 466 2– 466 8 15 Ray BK, Chatterjee S & Ray A (19 99) Mechanism of minimally modified LDL-mediated induction of serum amyloid A gene in monocyte/macrophage cells DNA Cell Biol 18 , 65 – 73 16 Ray...
- 11
- 439
- 0
Báo cáo khoa học: Eukaryotic class 1 translation termination factor eRF1 ) the NMR structure and dynamics of the middle domain involved in triggering ribosome-dependent peptidyl-tRNA hydrolysis pptx
... ± 21 )64 ) 43 )60 13 12 8 ± 12 ) 63 ± 30 )70 13 0 )60 17 48 ± 68 )12 8 ± 93 )12 0 45 18 0 51 )4 ± 13 90 58 )22 ± 46 )62 ± 10 5 ) 63 )40 )60 10 4 ) 13 5 ± 73 )87 )17 0 44 ) 23 ± 16 ) 63 )35 23 13 5 ± )11 0 ± 17 ... FEBS E V Ivanova et al 10 11 12 13 14 15 16 17 18 19 eukaryotic translation termination factor eRF1 RNA 8, 12 9 1 36 Ito K, Frolova L, Seit-Nebi A, Karamyshev A, Kisselev L & Nakamura Y (2002) ... Chi1 (v1) Residual dipolar couplings N–H Ca–Ha 19 75 428 2 36 448 8 63 12 214 96 97 21 120 Table Restraint violations and structural statistics for the calculated structures of the M domain of human...
- 15
- 538
- 0
Báo cáo khoa học: Coordination of three and four Cu(I) to the a- and b-domain of vertebrate Zn-metallothionein-1, respectively, induces significant structural changes doc
... 37 50 V, dry gas (6 LÆmin )1) temperature 30 0 °C and the nebulizer 17 2 .37 kPa For the a- domain, an average molecular mass of 30 21. 3 Da (30 21. 7 Da, theoretical) was observed, calculated from the ... function of 0.52 ± 0 . 13 A2 and RMSD values of 1. 04 ± 0 .12 A and 1. 51 ± 0 .18 A for the backbone and all heavy atoms, respectively Fig 1H-1H-NOESY spectra of Zn4aMT (red) superimposed with that of ZnxCu3aMT ... distorted chair The C-terminal a- domain is characterized by an adamantane-like four-metal cluster Solution structures of 11 3 Cd-substituted Cd7MT-2 from rabbit, rat and human are available and revealed...
- 14
- 485
- 0
MICROECONOMICSPrinciples and AnalysisFrank A. CowellSTICERD and Department of Economics London School of Economics December 2004.ii.ContentsContents List of Tables List of Figures Preface 1 Introduction 1.1 The rôle of microeconomic principles . potx
... 60 7 60 7 60 7 60 8 61 1 61 2 61 3 61 4 61 4 61 5 61 5 61 6 61 6 61 6 61 7 61 7 61 7 61 7 61 8 61 9 61 9 62 0 62 0 B Answers to Footnote Questions B .1 Introduction B.2 The …rm B .3 The …rm and ... combined s 10 2 10 3 1 06 10 9 11 0 11 1 11 4 11 5 1 16 6 .1 6. 2 6. 3 6. 4 6. 5 6. 6 6. 7 6. 8 6. 9 6. 10 6. 11 6. 12 Three basic production processes Labour and pigs produce sausages The technology ... 17 9 18 0 18 1 18 2 18 2 18 3 18 4 1 86 18 8 19 0 19 1 19 3 19 4 19 5 1 96 19 7 19 8 19 9 200 2 01 204 2 06 208 209 210 212 2 13 215 215 217 218 9 .1 9.2 9 .3 9.4 9.5 9 .6 Alf, Bill, Charlie and the Bomb Alf,...
- 668
- 5,134
- 0
Báo cáo khoa học: A characteristic Glu17 residue of pig carnitine palmitoyltransferase 1 is responsible for the low Km for carnitine and the low sensitivity to malonyl-CoA inhibition of the enzyme docx
... pGEMT–5¢HumanCPT1B as a template in a PCR reaction with primers DH6 73 (5¢-AGCTGAATTC ATGGCGGAAGCTCACCAG -3 ) and DH8 03 (5¢-TCCA CCCATGGTAGCAGAGAAGCAGCTTAAGGGTTTGG CGGA -3 ) The PCR reaction yielded a 422-bp ... 7.84 6. 31 2. 71 5. 36 2. 86 1. 70 Malonyl-CoA IC50 (lM) 0.804 ± 0 .15 7 0.0 96 ± 0.057 35 . 56 39 .19 0 .19 0 0 .32 5 0 .35 9 0.457 ± ± ± ± ± ± 1. 5 8a 15 .57b 0.078 0 .11 0b 0. 16 7 b 0 .18 1b P < 0.05 previously characterized ... To obtain D18PigCPT1B and D28PigCPT1B, deletion primers DH6 71 (5¢-AGCTGAATTCATGGTCGACTTCAGGCTC AGC -3 ) and DH 762 (5¢-AGCTGAATTCATGAAACATA TCTACCTGTCCGGG -3 ) were used in combination with the reverse...
- 9
- 550
- 0
Báo cáo khoa học: Structure–function relationship of novel X4 HIV-1 entry inhibitors – L- and D-arginine peptide-aminoglycoside conjugates pptx
... Neamine Neomycin – Neamine Neomycin – r6 Neam-r6 Neo-r6 r9 Neam-r9 Neo-r9 R9 997 .17 8 13 01. 5 23 15 93. 809 1 465 .742 17 70.0 76 2 062 . 36 2 1 465 . 710 997 . 61 13 01. 80 15 94 .14 1 466 .00 17 70. 43 2 0 63 .00 1 466 . 13 ... compounds 1a, 2a and 3a MS: m ⁄ z MALDI-TOF; Compound 1a: 747 .1 76 (M+Na), calcd., 747.5 86; Compound 2a: 11 52 . 61 (M+.), calcd., 11 52. 16 3 ; Compound 3a: 13 07 .3 91( M+Na), calcd., 13 07 .30 2 Also confirmed by 1H ... internalization in viral-cell fusion and as targets for entry inhibitors Biochim Biophys Acta 16 1 4, 51 61 Tachibana K, Hirota S, Iizasa H, Yoshida H, Kawabata K, Kataoka Y, Kitamura Y, Matsushima...
- 14
- 433
- 0
Chronicles (1 of 6): The Historie of England (4 of 8) The Fovrth Booke Of The Historie Of England doc
... for feare of the British fléet that passed to and fro at pleasure, to the great annoiance of the Romane subiects inhabiting alongst the coasts of Gallia, Maximian both to recouer againe so wealthie ... onelie the name of Camelodunum was onelie knowne, and Camaletum peraduenture neuer séene nor heard of As for example, an Englishman that hath heard of Waterford in Ireland, and not of Wexford, ... the heauie armed with weapons at hand, sought to make slaughter and wracke of them on ech side, so that this was a verie dolefull day to the Britains The wife and daughter of Caratake were taken...
- 70
- 405
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha chỉ tiêu chất lượng 9 tr 25